ID: 1107737270

View in Genome Browser
Species Human (GRCh38)
Location 13:43412969-43412991
Sequence CAGAATCTGATGACCTCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107737270_1107737274 -2 Left 1107737270 13:43412969-43412991 CCCTCGGAGGTCATCAGATTCTG 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1107737274 13:43412990-43413012 TGCAAAACGGGACAGAAGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107737270 Original CRISPR CAGAATCTGATGACCTCCGA GGG (reversed) Exonic
900593424 1:3469737-3469759 CGGAGTGTGATGACCTCTGAGGG + Intronic
903784590 1:25850418-25850440 CAGAAATTCATGACATCCGAGGG - Intronic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
913405895 1:118490075-118490097 TAGAATCTGATGCCCTCTGAGGG - Intergenic
921502188 1:215918337-215918359 CATAACCTGATCACCTCCCAAGG - Intronic
1062957344 10:1549045-1549067 GAGAATCTGAAGACGTCTGAGGG + Intronic
1067963947 10:50888007-50888029 CAAAATCTGATGATTTCCGTAGG + Intergenic
1068674739 10:59759191-59759213 CAGAATCTGATAACCCACCAGGG - Intergenic
1072705550 10:97678374-97678396 CAGGACCTGATGACCTCCAAAGG + Intronic
1073831243 10:107385709-107385731 CAGAATCTGATCACTTCCGTAGG + Intergenic
1073935959 10:108632228-108632250 AAGATTCTGATGACCTCTGGTGG + Intergenic
1074014521 10:109520381-109520403 CAGAATCTCTTGACCTTAGAAGG - Intergenic
1077301438 11:1848960-1848982 CGGAATCTGATGCCCTCAGCTGG + Intergenic
1084459647 11:69289386-69289408 CAGCATCTGATCACCACCCAGGG + Intergenic
1096914506 12:55017244-55017266 CAGAAGCTAGTGATCTCCGATGG + Intergenic
1104535904 12:129617812-129617834 CATAATCTAATCACCTCCCAGGG + Intronic
1107737270 13:43412969-43412991 CAGAATCTGATGACCTCCGAGGG - Exonic
1113512359 13:110866448-110866470 CATGATCTGATCACCTCCCACGG + Intergenic
1122113563 14:99517046-99517068 CAGCATCTGAGGACTTCTGAGGG + Intronic
1130510996 15:84589011-84589033 CAGAAACTCCTGACCTCCGGTGG + Intergenic
1141125432 16:81397635-81397657 CAGAATCTGATGAGTCCAGAGGG + Intergenic
1141504633 16:84467533-84467555 CAGAAACTGTTGAGCTCAGAGGG - Intergenic
1141866311 16:86752332-86752354 GAGGATGTGATGAACTCCGAGGG - Intergenic
1142185813 16:88694261-88694283 CAGGATCTGCTGAGCTCTGACGG + Intergenic
1148938766 17:51188490-51188512 CAGAATATGATAACCTACCAAGG + Intronic
1149560797 17:57606588-57606610 CAGATTCTGAGGACCTCTGAGGG + Intronic
1152319228 17:79598866-79598888 CAGAATCTCATGACCTTTGAAGG + Intergenic
1153582656 18:6590747-6590769 CAGTCTTTGATGACCTCCTAGGG + Intergenic
1156332616 18:36138332-36138354 CAGGATCTGATGTCCTCCTCTGG - Exonic
1160432090 18:78819356-78819378 CAGAATCTGATGACCGTGGGAGG + Intergenic
1161496353 19:4588177-4588199 AAGAATCTCAGGACCTCCCATGG - Intergenic
926949401 2:18225683-18225705 CATAATCCAATGACCTCCCAAGG - Intronic
928829027 2:35456344-35456366 GAGAATCTGATGATCTGAGATGG - Intergenic
929547604 2:42865916-42865938 CAGCATGTGATTACCTCCTAAGG - Intergenic
938243658 2:129761553-129761575 GAGTATCTGAGGACCTCTGAGGG + Intergenic
940259775 2:151767458-151767480 CAGAATCTGAGGGCCTCCACAGG + Intergenic
941476401 2:165955997-165956019 AAGAATCTGATGATCTGAGATGG - Intergenic
942775640 2:179578696-179578718 CAGAATCTAATGACCTTAAAAGG - Intronic
944070183 2:195658325-195658347 CAGAACCTGAAGCCCTCCGTTGG + Intronic
1170382236 20:15774093-15774115 CAGAATCCTTTGACCTCCAAGGG - Intronic
1174215446 20:48912640-48912662 CACCAGCTGGTGACCTCCGAGGG - Intergenic
1181349645 22:22245691-22245713 CAGAATCAGATGACACCAGAGGG - Intergenic
1184032410 22:41902822-41902844 CAGAGTCTGGTGAACTCCGCAGG - Intronic
958913944 3:100026699-100026721 CAGAATCTGATCACTTCTTACGG + Intronic
960068280 3:113398972-113398994 CAGAAGCTGATGACCTTTTATGG - Intronic
964184700 3:153928812-153928834 CAGAATCTGATGACCATTCAAGG - Intergenic
967132669 3:186486989-186487011 CAGAATCTGATAACCCACAAGGG - Intergenic
967824464 3:193867562-193867584 CAGGACCTAATGACCTCCCAAGG + Intergenic
972873558 4:43329949-43329971 CATAAGCTAATGACCTCCCAAGG + Intergenic
974197357 4:58592803-58592825 CTGAATCTAATGACCTCCAAAGG + Intergenic
974698384 4:65404888-65404910 AAGAATCTGATGAACCCAGATGG + Intronic
975062566 4:70020442-70020464 CAGAAGCTGATTACATCCTAAGG - Intergenic
976747069 4:88414083-88414105 CAGCATCTGCTGACCTTCAAGGG + Intronic
976867779 4:89751509-89751531 CCCAATCTGGTGGCCTCCGAAGG + Intronic
979669610 4:123348218-123348240 TTGAATCTGATAACCTCTGAAGG - Intergenic
979738723 4:124122545-124122567 CCTACTCTGATGGCCTCCGAGGG + Intergenic
982774543 4:159428264-159428286 CAGAATCGGGTGACATCTGATGG - Intergenic
987485218 5:18517817-18517839 CAAAATCAGATTACCTCCAAGGG - Intergenic
993333947 5:86633917-86633939 CAGAATCTGAAGACCTCTCTAGG + Intergenic
999554954 5:152729988-152730010 CAGAATCTGTTGCCTTCAGAAGG - Intergenic
1003588682 6:7417844-7417866 TATAATCAGATGACCTCAGATGG - Exonic
1005343847 6:24869714-24869736 CAGAATCTAATGACTTCCATTGG - Intronic
1006365306 6:33611584-33611606 CAGGATGGGATGACCTCAGAGGG + Intergenic
1006390410 6:33754999-33755021 CAGAATCTCAGAACCTCCCAGGG - Intergenic
1010280503 6:74018021-74018043 CATAATCTAATCACCTCCCATGG - Intergenic
1012951248 6:105520267-105520289 CAGCATCTGGTTACCTCCCAGGG - Intergenic
1012999019 6:106003276-106003298 CAGTATCTGATGACCTGCCAGGG - Intergenic
1013551981 6:111216940-111216962 CACAATCTGAGGGCCTCTGAAGG - Intronic
1016792162 6:148077344-148077366 GAGAATGTGTTGACCTCCAAGGG + Intergenic
1027437139 7:78175929-78175951 CAGAACCTCCTGACCTCCGCAGG - Intronic
1028178700 7:87689255-87689277 CAGAAATTGATGATCTCTGATGG + Intronic
1032237143 7:130134965-130134987 CTGAATCTAATGACCTTAGAAGG - Exonic
1035202649 7:157277132-157277154 CAGAGTCTGTTGACTTCGGATGG + Intergenic
1042062234 8:64833256-64833278 CAGACTCTGAAGACATCAGAAGG - Intergenic
1044372816 8:91433323-91433345 CAGAATTTGATGAACTCAGAAGG + Intergenic
1045141308 8:99286663-99286685 CAGAATCAGATAACCTGCAAGGG + Intronic
1049878882 8:145047745-145047767 CAGAATCACTTGACCTCAGAGGG + Intergenic
1050933309 9:11359688-11359710 CAGAATATGATGACCTCCACAGG - Intergenic
1053103762 9:35393256-35393278 CAGATTCTGAGGACCTGGGAAGG + Intronic
1058826686 9:108781554-108781576 CAGAACCTGATGCCTTCTGAGGG - Intergenic
1059741555 9:117155574-117155596 GAGACTCTGATAACCTCAGAAGG + Intronic
1061408457 9:130405446-130405468 CAGAATCTGATGAGTGCTGAGGG - Intronic
1061465472 9:130775824-130775846 GAGAAACTGATTACCTCCCAAGG + Intronic
1061649277 9:132033557-132033579 CACACTCTGATGACATTCGATGG - Intronic
1061729256 9:132600783-132600805 CAGAATTTGATGACCTTGGTTGG + Intronic
1185598751 X:1324838-1324860 CAGACTCTGAGGACCCCTGAGGG + Intergenic
1186143342 X:6600513-6600535 CATGATCTGATCACCTCCAAAGG + Intergenic
1186253578 X:7695670-7695692 CAGCATTTGATAACCTCCAAAGG + Intergenic
1195141422 X:101964464-101964486 CAGAATCTGTTGATCTTTGAGGG - Intergenic
1198695321 X:139330830-139330852 CTGAATCTGATGACCAATGATGG - Intergenic