ID: 1107740355

View in Genome Browser
Species Human (GRCh38)
Location 13:43444165-43444187
Sequence GTTTTAAGCAGACTGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107740355_1107740360 28 Left 1107740355 13:43444165-43444187 CCCCTTTTCAGTCTGCTTAAAAC 0: 1
1: 0
2: 2
3: 19
4: 224
Right 1107740360 13:43444216-43444238 CTGCTAAAACACAGTCTGCCAGG 0: 1
1: 0
2: 2
3: 26
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107740355 Original CRISPR GTTTTAAGCAGACTGAAAAG GGG (reversed) Intronic
901109529 1:6784621-6784643 ATTTTAAGCCGCCAGAAAAGGGG + Intergenic
905071608 1:35230669-35230691 GATTTTAACAGAATGAAAAGGGG + Intergenic
906399188 1:45492348-45492370 GTCTTAAGATGTCTGAAAAGGGG - Intergenic
906669491 1:47644165-47644187 GTTTTAAACAAACTGGAAAGGGG - Intergenic
907137640 1:52154721-52154743 ATTTTATGCAGAAAGAAAAGTGG - Intronic
907686879 1:56620480-56620502 GGTTTATTCAGACTGAAAATTGG + Intronic
907736680 1:57119983-57120005 GATTTTAGGAGACTAAAAAGAGG - Intronic
907898841 1:58719008-58719030 GTTTTTAGCATCCTGAAAATGGG + Intergenic
909511191 1:76454585-76454607 TGTTTAAGGAGACTGAAAATAGG + Intronic
910783890 1:90972767-90972789 GTATTATGCAGACTTAAAATGGG + Intronic
911746506 1:101447164-101447186 GTATAAAGCAGAGTGAGAAGCGG - Intergenic
912585256 1:110757975-110757997 GTTTTAAGGAGACTCAGAGGTGG - Intergenic
913313904 1:117533769-117533791 GCTTTAAGAAGGCTGAAAATAGG - Intergenic
915797183 1:158748207-158748229 TATATAAGCAGACTAAAAAGAGG - Intergenic
916313698 1:163424473-163424495 TTTTTAAGCAAACCTAAAAGAGG + Intergenic
917881849 1:179344683-179344705 GTTTTAAGCAGCAGGAAAACAGG + Intronic
918121338 1:181543585-181543607 GTTCTCTGCAGACTGAGAAGAGG + Intronic
918176619 1:182052047-182052069 GTTTAATGCAGAATGGAAAGAGG + Intergenic
918450938 1:184657367-184657389 GGTTTAAGCAAAATGAAAAGAGG - Intergenic
919404132 1:197155030-197155052 GTTTTAGGCAAACTGAAATAAGG + Exonic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921311829 1:213852050-213852072 GTTTTAAGGAGAGAGAACAGTGG - Intergenic
922663273 1:227448247-227448269 GATTTAAGCAGGCTGCTAAGTGG - Intergenic
922808939 1:228405531-228405553 GTTTTAAGCAGCAAGACAAGGGG + Intronic
922869594 1:228891377-228891399 GTTTAGGGCAGACTGAAACGTGG + Intergenic
923128593 1:231055182-231055204 GTATTAAGTAGACTGCAAAAAGG - Intergenic
923809499 1:237297359-237297381 GTGTTAAACACACTGAAGAGTGG - Intronic
924099785 1:240591376-240591398 GTTGTTAGAAAACTGAAAAGAGG + Intronic
1064477826 10:15710414-15710436 TTTTTAAGAAGAAAGAAAAGGGG - Intronic
1066052627 10:31649224-31649246 GTATTAAGAGGACTGAAAATTGG - Intergenic
1069084819 10:64126435-64126457 ATTTGAGACAGACTGAAAAGTGG + Intergenic
1069303025 10:66932114-66932136 GTGTTCAGCTGGCTGAAAAGGGG - Intronic
1069522756 10:69137899-69137921 ATTTTAAGCACACTTAAAATGGG - Intronic
1069550685 10:69361747-69361769 CTTTTAAGCAGCCTGAAAAGAGG + Intronic
1070753680 10:78978410-78978432 GAATTAAGCAGACTGAAAATGGG - Intergenic
1073317836 10:102595366-102595388 GTTTAAAGCAGAGAGAACAGAGG - Intronic
1073791922 10:106949275-106949297 GTTTGTAGCAGAGTGAAAACTGG + Intronic
1074453547 10:113578446-113578468 GTTTTAAGCAGGATTAAATGTGG + Intronic
1075506399 10:123026485-123026507 GTTGTAAGTAAACTGAAATGAGG - Intronic
1078110107 11:8385443-8385465 GTTTTAGGCAGAGGGAACAGGGG - Intergenic
1078559352 11:12357051-12357073 GTTTTAAGAAGAAAGAAGAGAGG - Intronic
1079847024 11:25485699-25485721 GTTGTAATCAAACTAAAAAGGGG + Intergenic
1080131076 11:28794700-28794722 GTTTGAAGTAAACTGAAAAGAGG + Intergenic
1082691110 11:56306367-56306389 CTTTTAAGAACACTAAAAAGAGG + Intergenic
1084578368 11:70005940-70005962 GTGTTTTACAGACTGAAAAGTGG - Intergenic
1085862574 11:80251862-80251884 ATTTGAAACAGACTGAAATGAGG - Intergenic
1086167806 11:83799619-83799641 GTGTTGAGCAGATTGAAAATGGG + Intronic
1087782498 11:102316338-102316360 GATTGAAGCAGACTCAAATGTGG + Intergenic
1091890617 12:4051258-4051280 GTTTGAAGTAGACTGAAATCAGG + Intergenic
1092094409 12:5829376-5829398 GTTTTAGGCAGAGTTAAAATGGG - Intronic
1094045421 12:26161146-26161168 GTTTTAAGCAGAGGGAAGACAGG - Intronic
1094071398 12:26418138-26418160 GATTTGAGAAGACTGAAATGAGG - Intronic
1094376635 12:29797264-29797286 ATGTTAAGCAGATTGAAAAAGGG - Intergenic
1095154962 12:38841745-38841767 TTTTCAAGCAGATTCAAAAGTGG - Intronic
1095161597 12:38923913-38923935 TTATTAAGCAGAATAAAAAGCGG - Intergenic
1101715901 12:107311685-107311707 ATTTGAAGCAGACTGAAATTGGG + Intergenic
1103375577 12:120453022-120453044 GTTTGATGCAGACTGGAATGGGG - Intronic
1106431029 13:29680785-29680807 GATTTAAGCTGACTCCAAAGAGG + Intergenic
1106717790 13:32408982-32409004 CTTCTAATCAGACTGAAATGAGG + Intronic
1107072608 13:36287176-36287198 ATTTAAAGCAGGCAGAAAAGAGG - Intronic
1107740355 13:43444165-43444187 GTTTTAAGCAGACTGAAAAGGGG - Intronic
1107757000 13:43635272-43635294 GTTTTATTCAGACTTAAAACCGG + Intronic
1108437487 13:50414988-50415010 GTTTTAGGGAATCTGAAAAGGGG - Intronic
1109072841 13:57790331-57790353 TTTTTAAGAACACTGGAAAGTGG - Intergenic
1109958311 13:69598725-69598747 GTTTTAAAAAGGCAGAAAAGGGG - Intergenic
1113047327 13:106169966-106169988 GGGTAAAGCTGACTGAAAAGTGG + Intergenic
1114670121 14:24406514-24406536 GTTTTGAACTGATTGAAAAGGGG + Intronic
1115136780 14:30119113-30119135 GTTGGAAGCAAACTGAAAATAGG + Intronic
1116295538 14:43102267-43102289 TTTTTAAGCAGGCTGAAAATAGG - Intergenic
1117251508 14:53944066-53944088 GATTTAAGTATTCTGAAAAGTGG - Intergenic
1118165752 14:63333967-63333989 GTTTTAAGGAGGCTGAAGATAGG - Intergenic
1119050271 14:71360774-71360796 GTTTTAAAGAAACTGAAATGAGG + Intronic
1119233607 14:73001042-73001064 GGTTTAGGAAGACTGAAAGGAGG - Intronic
1121034783 14:90692715-90692737 GTTTTATGAATACTGAGAAGAGG + Intronic
1123785687 15:23669881-23669903 GTTTTAAGAAAACTGAAAAGTGG + Intergenic
1126167294 15:45664498-45664520 GTTTAAAGCAGAATAAAGAGGGG - Intronic
1126536196 15:49768188-49768210 TTTTTATACAGACAGAAAAGTGG - Intergenic
1126614517 15:50563369-50563391 GTTTTAAGCAGTCTCAAGAGAGG + Intronic
1127552514 15:60054839-60054861 GTTTGAAGCATGCTGAAAACTGG + Intronic
1128383921 15:67133761-67133783 TTTTTCAACAGTCTGAAAAGTGG + Intronic
1129979537 15:79854902-79854924 GGTTGCTGCAGACTGAAAAGTGG + Intronic
1130814028 15:87411665-87411687 GGGTTAAGAAGACTGAAAAATGG - Intergenic
1132281572 15:100620742-100620764 GTTTTTAGAAGACTCAAAATTGG - Intronic
1133253982 16:4504983-4505005 GTTTTAAGCATACAGAAAAATGG + Intronic
1133457667 16:5956989-5957011 GTTTTAAGTAGGCTGAAACTTGG + Intergenic
1134630426 16:15752274-15752296 GTTTTAAGCATGCTAAAAAAAGG - Intronic
1135243472 16:20832342-20832364 GTTTTTAATAGACTCAAAAGAGG - Intronic
1140975905 16:80059972-80059994 TTTTTGATCAGACTGAACAGGGG + Intergenic
1141397915 16:83721070-83721092 GTTTGATGTAGACTGAGAAGTGG + Intronic
1146248143 17:31309675-31309697 TTTTTCAGCTAACTGAAAAGAGG - Intronic
1146533368 17:33629245-33629267 ATCTTAACCAAACTGAAAAGTGG - Intronic
1147029614 17:37621836-37621858 ATTTTAAGCAGAATAAAAAAAGG - Intronic
1147315576 17:39618553-39618575 ATTTTATGCAGAATGAAAATGGG - Intergenic
1148006687 17:44437426-44437448 GATGTAAGCCCACTGAAAAGAGG + Intronic
1148531179 17:48393933-48393955 GTTTTAATCTGACTAAAAATAGG + Intronic
1148957908 17:51369328-51369350 GTTTTGGGTAGACAGAAAAGTGG + Intergenic
1149050352 17:52296993-52297015 ATTTTAAGCACTCTGAAAATAGG - Intergenic
1149975141 17:61257889-61257911 GTTTGAACCAGAGTGAAAATGGG - Intronic
1153559455 18:6357157-6357179 GACTTAAGCAGACTGAAACAAGG - Intronic
1155768214 18:29663995-29664017 GCTTTAAGAAAACTGAAAAGAGG + Intergenic
1157654999 18:49376633-49376655 GTTTTGAGAAAACTGAAAGGTGG - Intronic
1158436863 18:57440208-57440230 GTTTTCAGCAACCTGACAAGAGG + Intronic
1158443694 18:57500409-57500431 GTTATAAGTAGAAAGAAAAGTGG + Intergenic
1158516834 18:58137930-58137952 GGTCTGAGCACACTGAAAAGAGG - Intronic
1159334937 18:67049925-67049947 TTTATATGCAGACTGAAGAGGGG - Intergenic
1159536043 18:69716376-69716398 ATTTTAAGCATAATTAAAAGTGG + Intronic
1159621155 18:70640143-70640165 TTTCTAAGCAGACTGGTAAGTGG + Intronic
1159989644 18:74889395-74889417 GTATTAAGCCGAGTAAAAAGAGG - Intronic
1160326051 18:77949446-77949468 GTTTTAAGCACCTTGAAAATGGG + Intergenic
1160814377 19:1028455-1028477 GTTTCAAGCAGCCGGTAAAGCGG - Intronic
1168525708 19:57087451-57087473 GTTCAAAACATACTGAAAAGGGG + Intergenic
1168578474 19:57533840-57533862 GAGTTAAACAGACTGAAAAATGG - Intronic
928058302 2:28081735-28081757 TTTTTAAGCCAAATGAAAAGAGG + Intronic
929646396 2:43632986-43633008 ATTTTAAGGCAACTGAAAAGAGG - Intergenic
930886660 2:56333986-56334008 GTTTTAGGCAGAAAGAAAGGTGG - Intronic
931773403 2:65518680-65518702 GTTTTAAGCAGAAAGAAAGGAGG - Intergenic
931906492 2:66848956-66848978 ATTTTAACCAGACTAAAATGTGG + Intergenic
933466679 2:82659939-82659961 GTTATAAGCGGAGTGACAAGAGG + Intergenic
933538245 2:83604384-83604406 TTTTTAAGAAGACTGAAAATAGG - Intergenic
935374595 2:102381847-102381869 CTTTTAACCTGACTTAAAAGTGG + Intronic
935641799 2:105297904-105297926 CTTTGAAGCAGACCGAAAAGTGG - Intronic
937992377 2:127671839-127671861 GGCTTAAGCAAACTGTAAAGTGG - Intronic
940502529 2:154511414-154511436 CTTTTTGGCAGACTGAAAAATGG - Intergenic
942589504 2:177526875-177526897 GCATTAAGCAGAATTAAAAGAGG - Intronic
942849926 2:180472537-180472559 TTTTTAAACCGACTGAAAAGTGG - Intergenic
942980986 2:182081376-182081398 TTTGAAAGAAGACTGAAAAGAGG - Intronic
944041143 2:195356460-195356482 TTTTTAAGCAGCCTTGAAAGTGG + Intergenic
944294242 2:198044001-198044023 GTTTTAAAAAGAGTGAAAACTGG - Intronic
944930117 2:204508735-204508757 TTTTTCTGCAGACTGAAAAAAGG + Intergenic
945796270 2:214368267-214368289 GTTGGAAGCAGAATGAAATGTGG - Intronic
1169155481 20:3326378-3326400 TTTTTAAACAGAATGAAAAAAGG + Intronic
1177257423 21:18683535-18683557 GATTTAATATGACTGAAAAGGGG - Intergenic
1181847166 22:25720172-25720194 TTTTCAAACAGCCTGAAAAGTGG - Intronic
949258495 3:2078976-2078998 GTTTGGAACATACTGAAAAGAGG + Intergenic
949706500 3:6824115-6824137 TTTTTATGCAGAGTGAAATGAGG + Intronic
950230095 3:11268882-11268904 GCCTTATGCAGTCTGAAAAGGGG - Intergenic
952644761 3:35641375-35641397 GTTTTAAGTAAACAGAGAAGTGG + Intronic
953073855 3:39550103-39550125 ATTTTAAGCAGAGGGAAAATAGG - Intergenic
953107766 3:39901977-39901999 GTTTTAAGCTGAGTGAGAAAGGG + Intronic
953169014 3:40490596-40490618 TTGTTAAGCAGGCTGAGAAGGGG - Intergenic
954900167 3:54012389-54012411 TTTTTAAGATGACTGAAGAGAGG - Intergenic
963096917 3:141552596-141552618 GTTTTAAGCAGTATGTACAGTGG + Intronic
963213379 3:142718560-142718582 TGTTTAAGGAGACTGAAAATAGG - Intergenic
964674068 3:159258060-159258082 GCTTTAAGCACACTGAAACCCGG + Intronic
967857949 3:194132527-194132549 ATTTTAAACAGATGGAAAAGTGG - Intergenic
968038113 3:195565726-195565748 ACTTTAAGCAGTCTGGAAAGAGG - Intergenic
969276013 4:6136311-6136333 GGTTCAAGCAGACTGAAATATGG - Intronic
970499859 4:16666094-16666116 GTTTTAAGCAGCCTGGATTGTGG + Intronic
971061124 4:22971097-22971119 GATTTAAGCAGACTTGAAGGAGG - Intergenic
971736172 4:30455611-30455633 GTTTTAAGCAGAGTGATATCAGG - Intergenic
972075666 4:35083082-35083104 GCTTGAAGCAGACTGAACACAGG + Intergenic
973973809 4:56242511-56242533 GATTTATGAAGACTGAACAGTGG + Intronic
976193410 4:82510603-82510625 GTTTAAAGCACACAGAACAGTGG + Intronic
977020998 4:91760031-91760053 GGTTTTAGCAAACTGAAAAGAGG + Intergenic
977862218 4:101976187-101976209 GTATTTAGAATACTGAAAAGAGG - Intronic
978154289 4:105472492-105472514 TTTTTAAGCAGATTGAAAAAAGG - Intronic
979068847 4:116174783-116174805 CCTTTAAGTAGACTGAAAATAGG + Intergenic
981191254 4:141866776-141866798 TCTTTAAGAAGACTGAAAACAGG + Intergenic
982183845 4:152776822-152776844 GTATAAAGCAGACTGAAATGGGG + Intronic
982645297 4:158016548-158016570 GTTATAAGTAAACTAAAAAGTGG - Intergenic
984541160 4:181039173-181039195 GTTTAAAACAGATTGAACAGAGG + Intergenic
984878180 4:184388102-184388124 TTTTAAAGCAGTCTGAAAATGGG + Exonic
986988854 5:13528380-13528402 ATTTAAAGAAGACTGGAAAGGGG - Intergenic
987064616 5:14276863-14276885 GTTTTAAGAAGAGGGAAATGAGG + Intronic
987533966 5:19161248-19161270 GTATTAAGAAGACTCTAAAGTGG - Intergenic
989573950 5:42971816-42971838 GCCTGAAGCAGACAGAAAAGGGG + Intergenic
990050340 5:51492261-51492283 GCTTTAAGTATATTGAAAAGTGG + Intergenic
991045429 5:62218020-62218042 GTTTTAAGTATAGAGAAAAGGGG - Intergenic
992901306 5:81299994-81300016 GTTTAAAGCAAACTAGAAAGTGG - Intergenic
993223544 5:85135755-85135777 TTTTTAAGGAAAATGAAAAGAGG - Intergenic
994181237 5:96768730-96768752 GGGCTAAGCAGACAGAAAAGGGG - Intronic
994977295 5:106826172-106826194 ATTTTAAGCATACTGGAAAAGGG + Intergenic
995236878 5:109839283-109839305 AATGTAAGCATACTGAAAAGAGG + Intronic
996030194 5:118696223-118696245 TGATTAAGGAGACTGAAAAGGGG - Intergenic
996387835 5:122927438-122927460 GTTTTAAACCATCTGAAAAGGGG + Intronic
997593227 5:135088246-135088268 ATTTTAAGAAGACAGGAAAGTGG + Intronic
997664461 5:135618321-135618343 GTTTTTAGCAGGCAGAAAATAGG + Intergenic
997765407 5:136498670-136498692 GGTTTAAGGAGGCTGAAAATAGG + Intergenic
998826842 5:146110645-146110667 ATTTTAAGCCTACAGAAAAGTGG - Intergenic
1000706669 5:164521333-164521355 ATTTTAACCAGAATGATAAGGGG + Intergenic
1004831202 6:19478319-19478341 GTTTCAAGTAGACTCCAAAGAGG + Intergenic
1005443072 6:25892587-25892609 GCTTTATGCAGAGTGACAAGGGG + Intergenic
1006559552 6:34898266-34898288 GTTTTAAAAAGCCTGAAAATTGG + Intronic
1006690234 6:35877540-35877562 TTTTTTAGAAGACTGAAAATGGG + Intronic
1006784297 6:36654920-36654942 CTTTTAAGCACAGTAAAAAGTGG + Intergenic
1007196871 6:40069555-40069577 GTTTTAAGCAGGTTAGAAAGTGG + Intergenic
1007823309 6:44578242-44578264 GTTTTAAACACAATGAAAATTGG + Intergenic
1008936946 6:57001580-57001602 GTTTTAAGAATGCTGAAAATAGG - Intronic
1009803391 6:68571657-68571679 TTTTTAAGAAGACTAAAAATAGG + Intergenic
1013870536 6:114753520-114753542 ATTATAAACATACTGAAAAGTGG + Intergenic
1014030704 6:116700110-116700132 GCGTTTGGCAGACTGAAAAGAGG + Intronic
1015715149 6:136184827-136184849 GGTTAAAGCAGAGTGAAAGGGGG + Intronic
1016074849 6:139783443-139783465 GATTAAAGTAGACTAAAAAGTGG - Intergenic
1017799511 6:157880605-157880627 TTTTAAAGCAGAATAAAAAGAGG - Intronic
1020934746 7:14448461-14448483 GTTTTGATAAGACTGGAAAGTGG + Intronic
1021325569 7:19262907-19262929 TTAATAAGCTGACTGAAAAGTGG - Intergenic
1022336867 7:29430548-29430570 GTTTAGAGCAGACTCAAAAAAGG - Intronic
1024134983 7:46397488-46397510 GTTTCATGAAAACTGAAAAGAGG + Intergenic
1025072784 7:55915501-55915523 GTTTTAAACAAAATGAAAACAGG + Intronic
1027558417 7:79695550-79695572 GTTTCCAGGAGACAGAAAAGTGG + Intergenic
1027694398 7:81391198-81391220 GTATAAAGCAGACAGAAAAAGGG - Intergenic
1027981648 7:85231878-85231900 GTTTTAGGCAGAGTAAAAAGAGG + Intergenic
1029351737 7:100017904-100017926 CTTCTAAGCAGGCTGAAAATTGG + Intronic
1029699779 7:102238718-102238740 GTTCCCAGCAGAGTGAAAAGTGG - Intronic
1031322410 7:120347922-120347944 GATTTAAGCAGTCTGAAACCTGG - Intronic
1034121548 7:148632640-148632662 ATTTTAAACACACAGAAAAGTGG - Intergenic
1034755640 7:153616680-153616702 GTTTTGAGGAGACAGAAAATAGG - Intergenic
1039149985 8:34493574-34493596 CTATTAAGAAGACTGATAAGTGG + Intergenic
1039322799 8:36451341-36451363 ATTTTAAGCATACTTAAAAATGG - Intergenic
1039344445 8:36688484-36688506 ATTCTAATCAGACTGAAGAGGGG + Intergenic
1039902165 8:41760711-41760733 CTTTTAAGCATCATGAAAAGGGG - Intronic
1040392148 8:46959509-46959531 CTTGGAAGCAGAATGAAAAGTGG + Intergenic
1041972732 8:63761490-63761512 GTCTTGAGTTGACTGAAAAGGGG + Intergenic
1043402156 8:79894316-79894338 GATTTCAGCAGACGGAGAAGAGG + Intergenic
1043484804 8:80688328-80688350 GTAATAAGCAGAATGGAAAGGGG - Intronic
1043594271 8:81865569-81865591 CTTTTAAGGACACTGAAAATAGG - Intergenic
1045237774 8:100370651-100370673 AATTTATGCAGCCTGAAAAGAGG - Intronic
1045767002 8:105684337-105684359 TTTTTAAGTAGAATGAAAATTGG + Intronic
1045968705 8:108055582-108055604 GTTCAAAACATACTGAAAAGAGG + Intronic
1046157641 8:110313988-110314010 GTTATTAGAAGAGTGAAAAGTGG - Intergenic
1046459291 8:114511683-114511705 CTTTACAGCAGACTGAAAAAGGG + Intergenic
1046654485 8:116877774-116877796 GCTTTAAGCAAACTCAACAGTGG + Intergenic
1047344202 8:124011244-124011266 GTTATAAGAAGACTGGAGAGGGG - Intronic
1047555314 8:125923143-125923165 GTTTCAAACAGACTGGAAATGGG + Intergenic
1048457176 8:134588831-134588853 ATTTTAAACAGACTGATAATAGG + Intronic
1049165940 8:141126550-141126572 GTTTTAAGGAGGAGGAAAAGGGG + Intronic
1050317725 9:4420280-4420302 GTTTTAAGGAGTTTAAAAAGAGG + Intergenic
1055202647 9:73685122-73685144 TTTTTAAGAAGACTGGAAAAGGG + Intergenic
1055563794 9:77548300-77548322 TCTTTAAGAAGACTGAAAATGGG - Intronic
1055677686 9:78681441-78681463 GTTTCAAACATACAGAAAAGAGG + Intergenic
1055876486 9:80948745-80948767 GTTTGAACCGGACTTAAAAGAGG + Intergenic
1057591086 9:96374061-96374083 GTTTCAAGCATACTGAAAACGGG - Intronic
1057889948 9:98862357-98862379 GTATTAAGCACACTGAAGATGGG - Intergenic
1058634871 9:107028734-107028756 GTCTTAAGCAGAAAAAAAAGGGG - Intergenic
1060795567 9:126510546-126510568 GTCTTGAGCAGAGTGAAAGGTGG + Intergenic
1186392167 X:9171835-9171857 GTAATAATCAGACAGAAAAGAGG - Intergenic
1186981598 X:14962817-14962839 GTTTAAAGGAAACGGAAAAGGGG - Intergenic
1189722137 X:43930945-43930967 TTTTTAAGAAGACTGAAAAAGGG - Intergenic
1192343630 X:70283522-70283544 CTTTTAAGGAGACAGATAAGTGG + Exonic
1193684909 X:84565980-84566002 GTTTTAAGTAGCTAGAAAAGAGG + Intergenic
1194876757 X:99199429-99199451 GTTTTAAGCTGAAAGAAAAAGGG - Intergenic
1195162694 X:102185985-102186007 GTTTGAAGCAGTATGAAAAATGG + Intergenic
1195166754 X:102227587-102227609 GTTTGAAGCAGTATGAAAACTGG + Intergenic
1195192106 X:102459501-102459523 GTTTGAAGCAGTATGAAAACTGG - Intronic
1195197189 X:102510421-102510443 GTCTTAAGTAGATTCAAAAGTGG - Intergenic
1200365751 X:155661331-155661353 TCTTTAAGAAGACTGAAAATAGG + Intronic