ID: 1107740766

View in Genome Browser
Species Human (GRCh38)
Location 13:43447496-43447518
Sequence CAGGGCACAGACTATCTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107740766_1107740773 17 Left 1107740766 13:43447496-43447518 CCTGCAAGATAGTCTGTGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1107740773 13:43447536-43447558 ACTGGAATTCTCTGGACCTTTGG 0: 1
1: 0
2: 0
3: 18
4: 179
1107740766_1107740771 9 Left 1107740766 13:43447496-43447518 CCTGCAAGATAGTCTGTGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1107740771 13:43447528-43447550 CCCTGTCTACTGGAATTCTCTGG 0: 1
1: 0
2: 0
3: 11
4: 103
1107740766_1107740774 18 Left 1107740766 13:43447496-43447518 CCTGCAAGATAGTCTGTGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1107740774 13:43447537-43447559 CTGGAATTCTCTGGACCTTTGGG 0: 1
1: 0
2: 2
3: 13
4: 160
1107740766_1107740769 -1 Left 1107740766 13:43447496-43447518 CCTGCAAGATAGTCTGTGCCCTG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 1107740769 13:43447518-43447540 GACTTACATTCCCTGTCTACTGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107740766 Original CRISPR CAGGGCACAGACTATCTTGC AGG (reversed) Intronic
901190517 1:7407335-7407357 GAGGGCACAGGCTGTCTTGGGGG + Intronic
902225149 1:14992075-14992097 CAGGGCACTCACTGTCATGCTGG - Intronic
910195203 1:84633200-84633222 CAGATTCCAGACTATCTTGCTGG + Intronic
911898759 1:103473585-103473607 CGGGGCAGTGACTTTCTTGCTGG + Intergenic
913430303 1:118783511-118783533 CAGGAAACAGACTCTCCTGCAGG + Intergenic
914234049 1:145792023-145792045 CAGGGCTCAGGCAATCCTGCCGG + Intronic
917644580 1:177017687-177017709 CAGGGCACACTCTGTCTGGCTGG - Intronic
918260394 1:182790214-182790236 CTGGGCAGAGAATATCTTGAGGG - Intronic
918833708 1:189432039-189432061 CAGGGCTGAGATCATCTTGCTGG - Intergenic
921817110 1:219576557-219576579 CAGGGAAGAGAATATCTAGCTGG - Intergenic
1063385226 10:5612370-5612392 AAGGGCACAGGAAATCTTGCTGG - Intergenic
1063419349 10:5898789-5898811 CATGGCACAGACTATATGTCTGG + Intronic
1066045122 10:31588050-31588072 CAAGGTACAGACTCTCTTGCAGG + Intergenic
1069679968 10:70277451-70277473 CAGGGCACAGAGACTCTGGCAGG + Intronic
1071359300 10:84829761-84829783 CAGGGCACAAACCATTTAGCAGG - Intergenic
1077340940 11:2026038-2026060 CAGGGCACAGGCTGTGCTGCTGG - Intergenic
1080640532 11:34155858-34155880 CAAGGCACACACTATCTGGAGGG - Intronic
1087842881 11:102938053-102938075 CAGGGCACAGATTGTCTATCAGG - Intergenic
1089318312 11:117607120-117607142 CAGGGGACTGACTCTCTTCCGGG + Intronic
1202823925 11_KI270721v1_random:81227-81249 CAGGGCACAGGCTGTGCTGCTGG - Intergenic
1096844682 12:54399644-54399666 CTGGGCCAAGACTTTCTTGCAGG - Exonic
1097374244 12:58821706-58821728 GAGAGCACAGACTGTCTTGATGG - Intergenic
1098996234 12:77123863-77123885 CAGAGCACAGAATATTTTGAGGG - Intergenic
1102058649 12:109915577-109915599 CCGGGCAGAGTCTGTCTTGCCGG - Intronic
1104007828 12:124906635-124906657 CAGGGGACAGAGTATTTTGAGGG + Intergenic
1107740766 13:43447496-43447518 CAGGGCACAGACTATCTTGCAGG - Intronic
1108295176 13:49009624-49009646 CAGGGCACACACATTCATGCAGG - Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1118585902 14:67353021-67353043 TAGGGCACAGACCATCATGAAGG - Exonic
1118929109 14:70223717-70223739 CACGTCACAGACTAACTTGCCGG + Intergenic
1122010351 14:98741381-98741403 CAGGTCACAGGCCATCTTTCTGG + Intergenic
1122206701 14:100151193-100151215 CAGGGCTCAGACTAATGTGCTGG - Intronic
1125391125 15:39194258-39194280 CAGGGCAGAGACTACCTTCCTGG - Intergenic
1127188782 15:56507437-56507459 CAGTGCACACAATATCTAGCAGG + Intergenic
1135802157 16:25507450-25507472 CAGAGCACACACTCTATTGCAGG - Intergenic
1135986358 16:27187579-27187601 AAGGGTACATACTATCTGGCTGG - Intergenic
1136120492 16:28130051-28130073 CAAGGCACAGCTTGTCTTGCTGG - Intronic
1138108076 16:54301394-54301416 CAGGGCACAGGCTGGCATGCTGG + Intergenic
1145897611 17:28469548-28469570 CCGGGCACAGACTGTCTGGACGG - Intronic
1148346768 17:46908507-46908529 AAGGGCACAGGCTAGCTTGGTGG + Intergenic
1151350273 17:73527757-73527779 CAGGGCAGAGACGATCTCCCAGG + Intronic
1151617909 17:75226373-75226395 CAGGGCACTGGCAATGTTGCTGG + Intronic
1152076743 17:78164576-78164598 CAGGGCACCCACCATCGTGCTGG + Intronic
1155021580 18:21901664-21901686 CAGGGACCAGAATTTCTTGCTGG + Intergenic
1157209035 18:45725552-45725574 GTGGGCACAGACTATCTTCACGG - Intronic
1161143789 19:2664980-2665002 CAGGGGACAGAGTATCTTGGGGG - Intronic
1166950759 19:46426593-46426615 CTGGGGACAGCCTCTCTTGCTGG - Intergenic
1168492399 19:56821784-56821806 CAGGGCCCAGTCCATCCTGCAGG + Intronic
925295139 2:2771410-2771432 CAGAGCACAGCCTACCATGCAGG + Intergenic
928636910 2:33256138-33256160 CAGGGCACAGAATATCTCCTTGG + Intronic
931302483 2:60994115-60994137 CTGGCCAAAGACTATTTTGCTGG + Intronic
931484345 2:62675214-62675236 CAGGGCACAGACTACCCTACAGG - Intronic
942661390 2:178268955-178268977 CAGTGCACATACAATCATGCAGG - Intronic
944282282 2:197911793-197911815 AAAGGCACAGGCTATGTTGCAGG - Intronic
946467020 2:219921075-219921097 AAGGGGCCAGATTATCTTGCTGG + Intergenic
948426122 2:237887385-237887407 GAGGACACCGAGTATCTTGCGGG + Intronic
1169217807 20:3803555-3803577 CAGGGCAGACACTAGCTGGCTGG - Intronic
1169519628 20:6356852-6356874 CAGGGCCCAGGCTAACTGGCTGG + Intergenic
1172448265 20:35004238-35004260 CAGGTCACAGGCTGACTTGCAGG - Intronic
1172707399 20:36892084-36892106 CAGGGCACAGCCTAGTTTGGGGG + Exonic
1175558608 20:59896176-59896198 CAGGACACAGCATATCTTACTGG - Intronic
1183779642 22:39990548-39990570 CATTGCACAGAGTATTTTGCTGG + Intergenic
1184340759 22:43884672-43884694 CAGGCCACAGACTTTCTAGAGGG - Intronic
1185242623 22:49754838-49754860 CCGGGCACAGCCTGTCTTGCAGG + Intergenic
950483306 3:13258089-13258111 CAGAGCACAGAGGATTTTGCGGG + Intergenic
953607138 3:44419484-44419506 CAGGGCCCAGATGACCTTGCAGG + Intergenic
953621320 3:44535331-44535353 CAAATCACAGACTATCTTCCTGG + Intergenic
955334509 3:58073952-58073974 CAGGAGACAGATTCTCTTGCTGG - Intronic
956501590 3:69892561-69892583 CAGGGCACAGACCATTTTTATGG - Intronic
957764803 3:84609675-84609697 CAGTGCAAAGACTATCTGGATGG - Intergenic
959446246 3:106443389-106443411 CAGTGCTCAGACCATCTTGGAGG - Intergenic
970008030 4:11428883-11428905 CAGGGCGCAGAGGACCTTGCAGG + Exonic
972812264 4:42603154-42603176 CAGAGAACACACTATCTTCCTGG + Intronic
978547419 4:109886557-109886579 CAAGAAGCAGACTATCTTGCAGG - Intergenic
978709018 4:111754682-111754704 CATGGCACATACTATGTTCCAGG + Intergenic
996583293 5:125055784-125055806 CAGGGCAGAGACTAGGTTGAAGG + Intergenic
997364500 5:133317324-133317346 CATGGCACAGTTTATCTTGCTGG + Intronic
998161724 5:139816773-139816795 GAGGGCACAGACAAGCTGGCCGG - Intronic
998975529 5:147642251-147642273 CAGGGAACAGAGTAGCTAGCGGG + Intronic
999291402 5:150428704-150428726 CAGGGCAAATACCATCTGGCAGG + Intergenic
999702322 5:154239349-154239371 CAGGCCACGGACTACCTTTCAGG + Intronic
1004646285 6:17564583-17564605 CAGTGCACAGAATATAATGCTGG + Intergenic
1006314515 6:33282305-33282327 CAGGGCGCTGATTATCTTGTCGG - Intronic
1006926852 6:37661049-37661071 CAGGGAACAGACTGTCCTTCAGG - Intronic
1008231714 6:48990890-48990912 CAGTGCACAGCCAAGCTTGCAGG - Intergenic
1010379936 6:75212739-75212761 CAGGGCTCAGGGTAACTTGCTGG + Intergenic
1012119013 6:95340097-95340119 CTGGGCAAAGACTATGATGCAGG - Intergenic
1018419106 6:163626644-163626666 CAGGGCCAAGGCTTTCTTGCAGG - Intergenic
1019489084 7:1302812-1302834 CAGGACACAGCCTATCTTCAGGG - Intergenic
1025620904 7:63169885-63169907 CAGGTTACAAACCATCTTGCTGG + Intergenic
1029524662 7:101087599-101087621 CAGGGCACAGGCTGGCTTCCCGG - Exonic
1029953217 7:104608948-104608970 CTGGGCACTTACTATATTGCAGG - Intronic
1031642568 7:124182391-124182413 AAGGGCACAGCCTTTATTGCAGG + Intergenic
1032789429 7:135231711-135231733 CAGGGCAGAATCTATGTTGCTGG + Intergenic
1033205389 7:139416287-139416309 CAGGTCACAAACTAACTTGTGGG - Intronic
1034502898 7:151462455-151462477 CAGGTCACAGGCTAGCTTGCAGG - Intergenic
1035082030 7:156224258-156224280 TAGGACACAGACTCTCTAGCTGG + Intergenic
1045556525 8:103219640-103219662 CAGGGGTCAGACTATGCTGCAGG - Intronic
1046248819 8:111603203-111603225 CATGTCACAGACTCCCTTGCTGG - Intergenic
1048926508 8:139276906-139276928 CAGGGCACTGGCTATCTGCCAGG + Intergenic
1053678859 9:40465882-40465904 GAGCTCAAAGACTATCTTGCTGG + Intergenic
1054291937 9:63301420-63301442 GAGCTCAAAGACTATCTTGCTGG + Intergenic
1054505759 9:65910413-65910435 GAGCTCAAAGACTATCTTGCTGG - Intergenic
1189110170 X:38281114-38281136 CAGAGTATAGAATATCTTGCTGG + Intronic
1198215834 X:134553914-134553936 CGGGGCAAATAATATCTTGCTGG + Intergenic
1198724231 X:139659780-139659802 CATGGAAGAGACTATCTTTCTGG - Intronic