ID: 1107742721

View in Genome Browser
Species Human (GRCh38)
Location 13:43469639-43469661
Sequence GTGTATGTTCATATATTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 260}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107742721 Original CRISPR GTGTATGTTCATATATTGGA AGG Intronic
905195002 1:36269155-36269177 CTGTGTGTTCAGAAATTGGAGGG - Intronic
905329238 1:37180621-37180643 CTGTATCTTCATATATTAAATGG + Intergenic
906696176 1:47824888-47824910 GTGAATATGCATATGTTGGAGGG - Intronic
909310520 1:74140878-74140900 ATGTATGTTTTTATATTGGAAGG - Intronic
909627971 1:77740332-77740354 GTGTATATCCAGATATTTGAAGG - Intronic
910676039 1:89817945-89817967 CTGTGTCTTCATATAGTGGAAGG - Intronic
910704162 1:90108880-90108902 CTGGATGATGATATATTGGATGG + Intergenic
910872965 1:91851899-91851921 CTGAATGTGCATATAGTGGAGGG - Intronic
911133161 1:94411675-94411697 GTGAATGTACATGTATTGGGAGG - Intergenic
911923195 1:103793491-103793513 GTGTATGTGTATATATTGAGGGG - Intergenic
912145767 1:106792291-106792313 GTGTATGTTCACATTTTAAAAGG + Intergenic
913571899 1:120129028-120129050 GTGTATGCACATATATTTGTAGG + Intergenic
914292818 1:146290651-146290673 GTGTATGCACATATATTTGTAGG + Intergenic
914553862 1:148741434-148741456 GTGTATGCACATATATTTGTAGG + Intergenic
915684031 1:157613005-157613027 GTGTTTTTTCATATACTGGTTGG - Intergenic
916968692 1:169983526-169983548 CTGTATGTTGATATATGGTATGG - Intronic
918517444 1:185378503-185378525 GTGTGTATACATATATTAGAGGG + Intergenic
919821255 1:201473651-201473673 GTGTATGTACATCTATGGAAGGG - Intergenic
921144054 1:212335018-212335040 GTGTATGTTGCTATACTTGATGG + Intronic
922081756 1:222304334-222304356 GTGTGTGTGCATATATGGGTGGG - Intergenic
922136010 1:222826971-222826993 GAGTATGTGTATATATTGCAAGG + Intergenic
922438262 1:225627898-225627920 GTGTATGTTTATAAGTTGGTAGG - Intronic
923812071 1:237329668-237329690 ATATATGTTAATATATGGGAAGG + Intronic
1062961909 10:1578792-1578814 GTGTGTGTGCATATATGGGGGGG - Intronic
1064610718 10:17098930-17098952 GTTTATGTTCATGCATTGGCAGG + Intronic
1068263890 10:54622260-54622282 GTGTGTGTTTATCTATTGTAAGG + Intronic
1068906606 10:62332895-62332917 GTGTATGTTCATATGCTTGATGG + Intergenic
1071898227 10:90087950-90087972 GTGTACGTGTATATATTTGAAGG + Intergenic
1074012981 10:109503396-109503418 GTGTTTGTTCAAATATAGAAGGG - Intergenic
1075774762 10:124975360-124975382 ATGTATGTTGATATTTTGAAGGG - Intronic
1077744320 11:4883522-4883544 GTGTAATTTTATATATTGGATGG - Intronic
1077767510 11:5176566-5176588 GTGTGTGTACATATATATGAAGG + Intronic
1078669846 11:13355039-13355061 GTGTTTGTACATATATAGAAGGG - Intronic
1079410550 11:20183420-20183442 GTGTATGTGTATATTTGGGAAGG + Intergenic
1080544314 11:33300697-33300719 CTGTATGTTGATATATTTGTGGG + Intronic
1080929713 11:36797006-36797028 GTGTATGTGTATATTTTGGAGGG + Intergenic
1082176808 11:49069533-49069555 GTGTTTGTGAATTTATTGGATGG + Intergenic
1082681902 11:56184133-56184155 CTGTGTCTTCATATAGTGGAAGG + Intergenic
1084798194 11:71523378-71523400 CTGTGTCTTCACATATTGGAAGG + Intronic
1086077467 11:82869771-82869793 GTGCAGGTTCATTTATTGGGTGG + Intronic
1086688900 11:89766340-89766362 GTGTTTGTGAATTTATTGGATGG - Intergenic
1086716955 11:90073620-90073642 GTGTTTGTGAATTTATTGGATGG + Intergenic
1086779909 11:90890926-90890948 GTGTATGTTGATATATGTGGAGG - Intergenic
1087298252 11:96402545-96402567 GTATTTTTTCATATATTTGATGG - Intronic
1088694141 11:112352075-112352097 GTGTCTGTTCATATCCTTGATGG + Intergenic
1088710345 11:112502440-112502462 GTCCATGTTCATAGATTGGAAGG - Intergenic
1089193577 11:116676519-116676541 TTCCATGTTCATAGATTGGAAGG + Intergenic
1090121677 11:124035954-124035976 GTGTATATTTATTTATTGAATGG + Intergenic
1090898346 11:131001454-131001476 GTGTATGGTCATATATTCACAGG - Intergenic
1091626981 12:2128863-2128885 GTGTGTGCTCATCTATTGAATGG - Intronic
1093051640 12:14511196-14511218 GTGTGTGTTCATATATGGTAGGG - Intronic
1093129759 12:15376013-15376035 GTGTATGTTGATATGCTTGATGG - Intronic
1093298578 12:17423733-17423755 GTGTATTTGCATATATTGTTGGG + Intergenic
1093644989 12:21575336-21575358 GTGAATGTTAATATTTTGTAAGG - Intronic
1095268810 12:40192369-40192391 GTGTATGTGTATACATTTGAGGG - Intergenic
1095572947 12:43703137-43703159 ATATATGTTCAAATATTGTATGG + Intergenic
1097744835 12:63289934-63289956 GTGTCTGTTCATATTTTAAAAGG + Intergenic
1099949536 12:89285845-89285867 GTGTAGGTTTAAATATTGGCTGG - Intergenic
1099950641 12:89298636-89298658 TTCTATGTTCATGGATTGGAAGG + Intergenic
1101915870 12:108895489-108895511 GTGTATGTGCATATGTGTGATGG + Intronic
1103165806 12:118769478-118769500 GTGTGTGTGCATATATTGGTTGG + Intergenic
1104341456 12:127953669-127953691 CTGTATGATAATATAATGGAGGG + Intergenic
1105370573 13:19798413-19798435 TTCCATGTTCATAGATTGGAAGG + Intergenic
1106976404 13:35222088-35222110 GTTTATGATCATATATTAGATGG + Intronic
1107742721 13:43469639-43469661 GTGTATGTTCATATATTGGAAGG + Intronic
1108073029 13:46649113-46649135 TTGTATATTTATTTATTGGAGGG + Intronic
1108886768 13:55195160-55195182 GTCTATGTTCGTAAATTGGAAGG - Intergenic
1109434937 13:62286185-62286207 GTGTGTGTGTCTATATTGGAAGG + Intergenic
1109474944 13:62867996-62868018 GAGTATCTTCATATATTGTTTGG - Intergenic
1109624651 13:64958863-64958885 ATGTATGTACATGTAATGGATGG + Intergenic
1110020742 13:70467193-70467215 GAGAATGATCATATACTGGATGG - Intergenic
1110413120 13:75224813-75224835 ATGTTTGTCCATATATTGCATGG - Intergenic
1111333347 13:86790425-86790447 CTGTATCTTCACATGTTGGAAGG + Intergenic
1112490669 13:99860489-99860511 GAGTATGTTAATATCCTGGAGGG + Intronic
1114375761 14:22145005-22145027 CTATATTTTCATATATTTGACGG + Intergenic
1114834871 14:26192182-26192204 GTGAATGTTAAGATATTGGTTGG + Intergenic
1116117894 14:40680971-40680993 GTGTATGTTTATAGTTTTGATGG + Intergenic
1116854659 14:49941432-49941454 TTGTATGTCCATGCATTGGAGGG - Intergenic
1118947442 14:70400355-70400377 GTGTATGTTCCAAAATTGTATGG - Intronic
1119761041 14:77152058-77152080 GGGCATGTTCATAGAGTGGATGG + Intronic
1120694179 14:87625576-87625598 GTTTATGTATATATAGTGGAAGG - Intergenic
1121283150 14:92713838-92713860 GTGTTTGTACATGTAATGGATGG + Exonic
1121397484 14:93639234-93639256 ATGTATCATCATATATTGTATGG + Intronic
1121641521 14:95487639-95487661 GGGTATGTTCATTTTATGGACGG - Intergenic
1121810397 14:96882892-96882914 TTGAATGTTCCTATATTGGCAGG + Intronic
1122021477 14:98841368-98841390 GTGTATGTGAATATATGGGCAGG + Intergenic
1126728194 15:51654626-51654648 GGGAATGTTCATATATTGGAAGG - Intergenic
1127563074 15:60159730-60159752 GTAAATGTTGATATGTTGGAGGG + Intergenic
1129371026 15:75095257-75095279 GTATATTTTCATATATTTAATGG - Intronic
1129928841 15:79391363-79391385 GTGTATTTTCATAATTTTGAAGG + Intronic
1131218547 15:90560957-90560979 GTTTATTTTGACATATTGGATGG - Intronic
1131313689 15:91313612-91313634 GTCTATGTTGATGTATTTGATGG - Intergenic
1131955837 15:97735227-97735249 GTGTATGTGTATATGTTTGAGGG + Intergenic
1132252673 15:100345954-100345976 GTGGATGTTCAAGTTTTGGAAGG - Intergenic
1134343632 16:13368639-13368661 GTGAATTTTCTTATCTTGGAGGG + Intergenic
1134874053 16:17680491-17680513 GTGCATGTTGGTATATTTGATGG + Intergenic
1135475930 16:22774851-22774873 GTGTATGTCCATATTTTTTATGG - Intergenic
1136678057 16:31932587-31932609 ATATATTTTCATATATTTGAGGG - Intergenic
1137432061 16:48426607-48426629 GTGTATGTTCCCATACTGGTGGG + Intronic
1138935819 16:61721103-61721125 GTGAATATATATATATTGGAGGG - Intronic
1139299761 16:65934976-65934998 ATGTATTTTCATATATTTGGGGG + Intergenic
1140623535 16:76765056-76765078 GTCTATGTTCATGGATTAGAAGG + Intergenic
1140920385 16:79532061-79532083 GAGTAGGTTCCTATATTGCACGG + Intergenic
1144405037 17:14944081-14944103 CTGTATGTTAATACATAGGAAGG - Intergenic
1145872855 17:28290013-28290035 GAATATTTTCATATATTTGAAGG + Intergenic
1149875302 17:60226727-60226749 GTGTATGTACATAGAGTGAAGGG + Intronic
1151320427 17:73349299-73349321 GTGTGTGTTCATCTAGAGGATGG - Intronic
1152084994 17:78212591-78212613 GTGTGTGTTCACATATATGAGGG + Intergenic
1153823104 18:8849203-8849225 GTGTATGATCAGAAGTTGGAAGG - Intergenic
1155724016 18:29056448-29056470 GTCTCTGTTCTTATATTGAAAGG - Intergenic
1156621863 18:38862189-38862211 GTCTATATTCATAAACTGGAAGG + Intergenic
1156751065 18:40455724-40455746 GTTAATATTCATATATTTGAAGG + Intergenic
1157708275 18:49827686-49827708 GTGTATGTTGGTATACTTGATGG - Intronic
1159616787 18:70590411-70590433 GTGTATGTTCATTTGTTTGCTGG + Intergenic
1163456430 19:17408777-17408799 ATGTATTTTTATATATTGGTTGG + Intronic
925261786 2:2535673-2535695 GTGGATGCTCACATTTTGGATGG + Intergenic
926503043 2:13678401-13678423 GTGTATGTTAATATATTAGAAGG + Intergenic
927440906 2:23116864-23116886 GTGCATGTTCAGACCTTGGAAGG - Intergenic
927574958 2:24193265-24193287 GTGTATATACATATATTCAAAGG - Intronic
930343864 2:50152951-50152973 GTGTGTGTTCATTTGTTTGATGG + Intronic
930590672 2:53322930-53322952 TGGGATATTCATATATTGGAAGG - Intergenic
932508554 2:72261717-72261739 TTATATTTTCATATATTTGAAGG + Intronic
933176673 2:79181290-79181312 GTGGATTTTCATATTTTGGGGGG + Intergenic
934584341 2:95476916-95476938 GTGTTTGTGAATTTATTGGATGG - Intergenic
934595111 2:95599798-95599820 GTGTTTGTGAATTTATTGGATGG + Intergenic
934787655 2:97025729-97025751 GTGTTTGTGAATTTATTGGATGG - Intergenic
934874285 2:97901094-97901116 ATGTATTTTCATATTTTTGAAGG - Intronic
934930937 2:98422436-98422458 GTGTATGTTGATATGTTTAATGG - Intergenic
936439156 2:112535313-112535335 GTGTATGTTGGTATGTTTGATGG - Exonic
936673502 2:114686977-114686999 GATTTTGTTCATATATTGCAAGG - Intronic
936790972 2:116151386-116151408 GGGTATATTCATATATTCAAAGG - Intergenic
937684850 2:124684251-124684273 GTGTATATTCAGATATTGACAGG - Intronic
939111245 2:138010081-138010103 GTGTATGTTCATTTGTTTCAGGG + Intronic
939322106 2:140637468-140637490 GTGTATTTTCATACATTAGAAGG + Intronic
939393357 2:141597581-141597603 CTGCATGTTCTTATATTGGAAGG + Intronic
940364496 2:152832925-152832947 ATTCATGTTCATGTATTGGAAGG - Intergenic
940586694 2:155660944-155660966 GTGTATGGCCATATAGTGTATGG + Intergenic
941695662 2:168548547-168548569 TTGTGTGTTCATATATTAAATGG + Intronic
941923644 2:170875147-170875169 ATGTATCTTCATATAGTTGAAGG - Intergenic
942393702 2:175523934-175523956 GTTCATGTTCATACATTGGCTGG - Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
942483449 2:176414707-176414729 GTTTATGATCATATTTTGGTGGG + Intergenic
943315158 2:186378214-186378236 GTGTGTGTTTACATATAGGAAGG - Intergenic
945334543 2:208577005-208577027 TTCTATGTTCATGGATTGGAAGG + Intronic
945494405 2:210492071-210492093 TTGTCTATTCATATATTGGTAGG - Intronic
945762897 2:213936284-213936306 GAGTATGTACATATAATAGAGGG + Intronic
947957715 2:234208332-234208354 GTGTATGTTCAGATTTAGTATGG + Intergenic
1177285858 21:19048642-19048664 GTATTTGCTCATAGATTGGATGG + Intergenic
1178037764 21:28603789-28603811 GTGAAAGTTCATTTATTGCAAGG - Intergenic
1178390978 21:32198185-32198207 GTGCATGTGCACATATGGGAAGG + Intergenic
1179263595 21:39781447-39781469 GTGTATGTTCATATTTATGGAGG + Intronic
1180239232 21:46489149-46489171 GTGTATGCTCACATTTTGAAGGG + Intronic
1182034845 22:27189824-27189846 GTGTTAGTTCATCTATTGTAAGG - Intergenic
950588578 3:13917179-13917201 GTGTATTTTTATATATTGGTGGG - Intergenic
951747153 3:25991825-25991847 GTGTATGTTGTTACATTTGATGG - Intergenic
952586801 3:34903014-34903036 GAGTATCTTCATATAGTGGAAGG - Intergenic
954587664 3:51750560-51750582 GTGTGTGTATATATATTTGAAGG - Intergenic
955417643 3:58707284-58707306 GTGTGTGTGCATTTTTTGGAAGG - Intergenic
955422887 3:58757323-58757345 CTGTATTTTCATATATTTAAGGG + Intronic
957454801 3:80427803-80427825 TTTTATGTTCATGGATTGGAAGG + Intergenic
958164018 3:89855751-89855773 GAGTATGTTCATATGTTGTCAGG - Intergenic
958866811 3:99510174-99510196 GTGTAACTTCACATAGTGGAAGG - Intergenic
959017137 3:101147572-101147594 GTGTATGTTCAGGTATTGTTAGG - Intergenic
959310699 3:104732732-104732754 TTCAATGTTCATATATTGAATGG - Intergenic
960475714 3:118124306-118124328 TACTATGTTCATAGATTGGATGG - Intergenic
962300520 3:134238361-134238383 GTGTATGTTCATACACAGAAAGG + Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965090505 3:164156511-164156533 GTGTATGTTCAATAATTTGAAGG - Intergenic
967697523 3:192550328-192550350 ATGTATGCACATATATAGGAAGG - Intronic
969965157 4:10986474-10986496 CTGTGTCTTCATATAGTGGAAGG - Intergenic
971116797 4:23657666-23657688 TTATATATTCATATATTGGTTGG - Intergenic
971733708 4:30418610-30418632 TTTTATGTTCATAGATTAGAAGG + Intergenic
972977726 4:44658269-44658291 TTGTATCCTCACATATTGGAAGG - Intronic
973170563 4:47137859-47137881 TTATATATACATATATTGGATGG - Intronic
973887750 4:55339897-55339919 GTGTATGTTAAAATATTAGAAGG + Intergenic
974892935 4:67903351-67903373 TTCCATGTTCATAGATTGGAAGG - Intergenic
974931064 4:68361615-68361637 TTGTGTCTTCATATTTTGGAAGG + Intergenic
975015216 4:69407685-69407707 GTTTCTTTCCATATATTGGAGGG - Intronic
975526885 4:75360810-75360832 GTATATGTTAATTTATTTGATGG + Intergenic
976237910 4:82920349-82920371 GTGAATATTCAAAAATTGGAAGG + Intronic
977371065 4:96136765-96136787 CTTTATGCTCATATGTTGGAAGG - Intergenic
979123221 4:116929203-116929225 GTATATGTTCATATATTTGTTGG + Intergenic
980341451 4:131553531-131553553 TTGTATGTTTATATAGTAGAAGG - Intergenic
980535281 4:134112725-134112747 GTGTGTGTACATATATTTGTAGG + Intergenic
980600703 4:135020793-135020815 TTGTAAGTTCATCCATTGGAAGG + Intergenic
982342623 4:154318723-154318745 ATGTATGTTCATAGAGTGAAAGG + Intronic
982865666 4:160507886-160507908 GTGTATATTCACATATTGAAGGG - Intergenic
983457067 4:167978532-167978554 TTGCATGTTCATGGATTGGAAGG + Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
983989022 4:174095948-174095970 TACTATGTTCATGTATTGGAAGG + Intergenic
984432006 4:179661832-179661854 TTGTGTGCTCACATATTGGAAGG - Intergenic
986117341 5:4789930-4789952 GTCTATGTTCATACATAGGAAGG + Intergenic
986474544 5:8114140-8114162 GCACATTTTCATATATTGGAAGG - Intergenic
986543201 5:8869056-8869078 GTGTATCATCACATATTCGAAGG + Intergenic
987102933 5:14608382-14608404 GTGTGTCTTCACATAGTGGAAGG + Intronic
988118537 5:26928368-26928390 TTTTATGTTCATAGTTTGGAAGG + Intronic
988209298 5:28182732-28182754 GTATATGTACATATAATTGATGG - Intergenic
989114903 5:37942873-37942895 GTGTCTGTTCATATCTGGAAGGG - Intergenic
989359019 5:40578281-40578303 GTGTATGTGCATGCATTGGACGG + Intergenic
991160772 5:63499430-63499452 TTGTATGTTCGTATATTTTAGGG - Intergenic
993381408 5:87212829-87212851 GTGTTTTTTCATATATTTGTTGG + Intergenic
994494595 5:100494974-100494996 GCCTATCTTCATATTTTGGAAGG + Intergenic
994562396 5:101392786-101392808 GTATGAGTTCATATATTTGAAGG + Intergenic
997658739 5:135574459-135574481 GTGGGTGTTCACATATTAGATGG + Intronic
998711700 5:144833273-144833295 GTGAATGCTGATATATTTGAAGG - Intergenic
1000952371 5:167500040-167500062 GTGTTTGTACATATATATGAGGG + Intronic
1003077404 6:2994928-2994950 GTGGATTTTGATATATTTGAGGG - Intronic
1003167077 6:3689190-3689212 GTTTATTTACATTTATTGGATGG + Intergenic
1005342004 6:24851793-24851815 GTCTATGTTCATATTTTGCCAGG - Intronic
1005952312 6:30641098-30641120 GTGTATGTGTGTATATGGGATGG - Intronic
1008802694 6:55389295-55389317 GTGTCTGACCATATATTGAAAGG + Intronic
1009733422 6:67640704-67640726 GTGTATGTGCATAAATTGTCTGG - Intergenic
1009754128 6:67913126-67913148 TCTTGTGTTCATATATTGGAAGG - Intergenic
1009920836 6:70058697-70058719 GTTTATGTTAATAAATTAGAGGG - Intronic
1011636573 6:89380264-89380286 GTGTTTATTCATAAAGTGGATGG - Exonic
1012173302 6:96046638-96046660 TTGTATGTTCACATGTGGGAAGG - Intronic
1012652476 6:101773054-101773076 GTGTATGTTCATATGGGGCAGGG + Intronic
1012791441 6:103702760-103702782 ATTTATATTCATATATTTGAAGG + Intergenic
1012831253 6:104206068-104206090 GTGTGTCTTCACATAGTGGAAGG - Intergenic
1013842029 6:114407883-114407905 GTGTAGGATCATATATGGAAAGG + Intergenic
1014302664 6:119701833-119701855 CTGTGTGTTCATATAATGGAAGG - Intergenic
1015184573 6:130400043-130400065 GTGTATGTATATATATATGATGG - Intronic
1015268501 6:131314457-131314479 GTGTTTTTTCATATGTTTGATGG + Intergenic
1015702968 6:136056289-136056311 GTGTATGCACATATCTTGGCTGG - Intronic
1016075887 6:139795066-139795088 TTCTATGTTCATGGATTGGAAGG - Intergenic
1016797424 6:148132878-148132900 TTGTATCCTCATATAGTGGAAGG + Intergenic
1018133634 6:160756651-160756673 CTTCATGTTCATATATTGGCTGG + Intergenic
1020374912 7:7473910-7473932 GTGTTTGTTTATATATATGATGG + Intronic
1023185997 7:37533630-37533652 GCATATTTTCATATATTTGATGG + Intergenic
1024441385 7:49422521-49422543 GTGTATGTTGATACATTGTTGGG + Intergenic
1028345904 7:89781752-89781774 TTCTATGTTCATGTATTGGAAGG - Intergenic
1029150176 7:98474822-98474844 GTGTATCTAAATATATTGGCTGG + Intergenic
1030739676 7:113093389-113093411 GTGCATGTGAATGTATTGGAAGG + Intergenic
1036238327 8:7061713-7061735 GTGAATGTCCATATTATGGATGG - Intergenic
1036238604 8:7063960-7063982 GTGAATGTTCATATTATGGATGG + Intergenic
1036643379 8:10597771-10597793 GTTTATGTGCATGTATTGGGGGG - Intergenic
1037942462 8:22962664-22962686 GTGTATGATCATATAATAAAAGG + Intronic
1038389498 8:27181725-27181747 ATGTATGTTTATATATGTGATGG - Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040591947 8:48801291-48801313 TTTTATGTTCATGTATAGGAAGG + Intergenic
1040621308 8:49095864-49095886 GTATATGTTAACATATTGGAAGG + Intergenic
1041790160 8:61686655-61686677 GAGTATGTGGATATTTTGGAAGG - Intronic
1042050036 8:64693740-64693762 GTGTATGTGTATATATTGCATGG - Intronic
1043199257 8:77342734-77342756 GTGTATGTACATATTTTCCATGG + Intergenic
1043488692 8:80725340-80725362 GTTTATGTTCCAATATTGTATGG - Intronic
1044822936 8:96169731-96169753 GTGTAAGTTCCTTTATGGGAGGG - Intergenic
1045761635 8:105615488-105615510 GTGTATGTGTATTTATTGAAGGG + Intronic
1046059910 8:109126443-109126465 GTGTCTGTTCCAATATTGTATGG + Intergenic
1046222143 8:111229956-111229978 GTGTATATATATATATTTGAAGG + Intergenic
1046286580 8:112100730-112100752 GTATATCTACATATTTTGGAGGG + Intergenic
1046438992 8:114234210-114234232 CTGTGTCTTCATATGTTGGAGGG - Intergenic
1047938399 8:129803969-129803991 GCGTATGTTTACCTATTGGAAGG + Intergenic
1048698897 8:137062456-137062478 GTATATATACATATATAGGAAGG - Intergenic
1050195835 9:3083374-3083396 GTGTAAGTTCATAAATAGTATGG + Intergenic
1050739347 9:8802404-8802426 GTGAATGTTCTTCTATTTGAGGG - Intronic
1050807971 9:9706350-9706372 GTGTCTGATAATACATTGGAAGG - Intronic
1051116423 9:13699124-13699146 CTCTATGTTCATAGATAGGAAGG - Intergenic
1052258361 9:26485794-26485816 GTCAATGTTCATGGATTGGAAGG - Intergenic
1052356118 9:27506469-27506491 GTATATGTTCATATTCTGTATGG + Intronic
1052429377 9:28347384-28347406 GTGTATGTATATATATTAGGAGG - Intronic
1052977737 9:34423979-34424001 GTGTATGTTTATAAATAAGAAGG + Intronic
1055286429 9:74733243-74733265 ATGTATCTTCATATATTTGGGGG - Intronic
1055702988 9:78966445-78966467 GTGTGTGTTCATTTATCTGAGGG - Intergenic
1056734610 9:89197858-89197880 ATCTATGTTCATGGATTGGAAGG + Intergenic
1057523707 9:95781486-95781508 GTGTGTGTGCATGTATTGGGGGG - Intergenic
1058027069 9:100153419-100153441 GCATATTTTCATATATTGAAGGG - Intronic
1058191469 9:101921624-101921646 TTATACGTTCATATATTGTAAGG + Intergenic
1059040054 9:110803232-110803254 GTTTAAGTTCATATATTTAAAGG - Intergenic
1062205979 9:135337628-135337650 GTGTGTGTGCATATGTTTGAGGG + Intergenic
1185849276 X:3470171-3470193 GTGTATGTGGTTATATTAGAAGG + Intergenic
1186533717 X:10325589-10325611 GCATATGTTCATATGTTGGTTGG - Intergenic
1187204780 X:17171495-17171517 ATATATGTTCAGATATTAGAAGG - Intergenic
1188685088 X:33059780-33059802 GTGTATTTTCACATAGTGGTTGG + Intronic
1189265573 X:39713499-39713521 GTGTATGATCAGATGATGGATGG + Intergenic
1190428097 X:50351400-50351422 GTTTGTGTTCATTTATTGGGAGG + Intronic
1193574203 X:83179492-83179514 GTGTATGTTCCAAAATTGTATGG - Intergenic
1194038111 X:88904794-88904816 GTGTTTTTTCATATATTTGTTGG + Intergenic
1194421339 X:93677257-93677279 GTGTATGTTCATATTAAGGGAGG - Intronic
1194902876 X:99536209-99536231 GTGTATGTTGGTATTTTTGATGG - Intergenic
1198888377 X:141364116-141364138 ATATATGTTCAAATATTTGAAGG + Intergenic
1199351269 X:146803319-146803341 GTGCCTGTTCAATTATTGGATGG - Intergenic
1199352638 X:146821174-146821196 GTGCCTGTTCAATTATTGGATGG + Intergenic
1199352954 X:146825835-146825857 GTGCCTGTTCAATTATTGGATGG + Intergenic
1199534251 X:148884413-148884435 GGTTATGTTCAAATATTGAAAGG - Intronic
1200814382 Y:7516631-7516653 GTGTATGTGGTTATATTGGAAGG - Intergenic
1201633514 Y:16096301-16096323 GTGTATCCTCACATAGTGGAAGG - Intergenic
1202012329 Y:20357193-20357215 GTGTGTGTTCATATATATGTGGG + Intergenic