ID: 1107753947

View in Genome Browser
Species Human (GRCh38)
Location 13:43599324-43599346
Sequence AGGGAGAGTGCAGCGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 25, 3: 81, 4: 349}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107753947_1107753960 20 Left 1107753947 13:43599324-43599346 CCCACCATCGCTGCACTCTCCCT 0: 1
1: 0
2: 25
3: 81
4: 349
Right 1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG 0: 3
1: 17
2: 46
3: 132
4: 383
1107753947_1107753959 19 Left 1107753947 13:43599324-43599346 CCCACCATCGCTGCACTCTCCCT 0: 1
1: 0
2: 25
3: 81
4: 349
Right 1107753959 13:43599366-43599388 AAGGGAGAGTGCAGTGATAGTGG 0: 2
1: 6
2: 25
3: 99
4: 447
1107753947_1107753951 -5 Left 1107753947 13:43599324-43599346 CCCACCATCGCTGCACTCTCCCT 0: 1
1: 0
2: 25
3: 81
4: 349
Right 1107753951 13:43599342-43599364 TCCCTCCCCTAAACACACTTGGG 0: 1
1: 0
2: 3
3: 15
4: 151
1107753947_1107753955 0 Left 1107753947 13:43599324-43599346 CCCACCATCGCTGCACTCTCCCT 0: 1
1: 0
2: 25
3: 81
4: 349
Right 1107753955 13:43599347-43599369 CCCCTAAACACACTTGGGAAAGG 0: 1
1: 0
2: 2
3: 11
4: 120
1107753947_1107753957 1 Left 1107753947 13:43599324-43599346 CCCACCATCGCTGCACTCTCCCT 0: 1
1: 0
2: 25
3: 81
4: 349
Right 1107753957 13:43599348-43599370 CCCTAAACACACTTGGGAAAGGG 0: 1
1: 0
2: 4
3: 8
4: 152
1107753947_1107753950 -6 Left 1107753947 13:43599324-43599346 CCCACCATCGCTGCACTCTCCCT 0: 1
1: 0
2: 25
3: 81
4: 349
Right 1107753950 13:43599341-43599363 CTCCCTCCCCTAAACACACTTGG 0: 1
1: 0
2: 2
3: 32
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107753947 Original CRISPR AGGGAGAGTGCAGCGATGGT GGG (reversed) Intronic
900411815 1:2515993-2516015 AGGGTGACTGCAGCGGTGATTGG - Intronic
901686300 1:10945497-10945519 CGGGAGAGTGCAGCGGGGATGGG - Intergenic
903642447 1:24869193-24869215 AAGGAGAGTGTTGGGATGGTGGG + Intergenic
904030745 1:27532147-27532169 AGGGAGAGGGAAGTGATGGTAGG - Intergenic
904604824 1:31692561-31692583 AGGGATAGGGCAGGGATGGTGGG - Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906563501 1:46778691-46778713 AAGTCGAGTGCAGCGCTGGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910223898 1:84917017-84917039 AGGGAGAGTGAACTGATGGGAGG - Intergenic
910443534 1:87277582-87277604 ATGGGGAGTGCAGGGGTGGTTGG + Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
912332183 1:108830111-108830133 AAGGAGAGAGTAGGGATGGTGGG + Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
914353923 1:146865287-146865309 AGGGGGGGTGGAGAGATGGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916119061 1:161511924-161511946 AGGGAGGGAGCAGCGATGGGGGG + Intronic
916128820 1:161593583-161593605 AGGGAGGGAGCAGCGGTGGGAGG + Intronic
916597473 1:166258065-166258087 GGGGAGTGTGCAGCAGTGGTTGG + Intergenic
917168102 1:172136396-172136418 AGGGAGTGTGCAGATCTGGTAGG - Intronic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919169705 1:193938553-193938575 GGGGAGAGTGCAGCAATTGTGGG + Intergenic
920536719 1:206742121-206742143 AGGGAGTGTGAAGCGAGGCTGGG - Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922226065 1:223646794-223646816 AGGCAGAGAGCAGAGCTGGTAGG + Intronic
922273702 1:224057273-224057295 AGGGAGTGTGTAGGGATGGGAGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923524825 1:234764429-234764451 AGGGAGAGAGCATAGGTGGTGGG - Intergenic
923526538 1:234777116-234777138 AGGGAGAGGCCAGTGAAGGTCGG + Intergenic
923629848 1:235642614-235642636 AGGGAGAGGGCAGGGTTGGGAGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
1063545444 10:6976523-6976545 AGGAAGCTTGCAGCCATGGTGGG - Intergenic
1064112012 10:12547644-12547666 AGAGAGAGTGCAGGGTTGGGGGG - Intronic
1064446466 10:15398348-15398370 AGGGAGAGTGAAGCAATTGGAGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067497579 10:46773969-46773991 AGGGAGAGAGCAGGGGCGGTGGG + Intergenic
1067597072 10:47566446-47566468 AGGGAGAGAGCAGGGGCGGTGGG - Intergenic
1069172831 10:65254705-65254727 TGGAAGAGTGCTGAGATGGTGGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1070167459 10:73909605-73909627 AGGGAGAGTGCCAGGAAGGTAGG - Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1072238546 10:93473979-93474001 TGGGCGAGTGCAGGGCTGGTTGG - Intronic
1073748280 10:106494674-106494696 AGGGAGATGGCAGAGATGGAAGG - Intergenic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074672764 10:115812893-115812915 AGGGACAGTGAAGCGAAAGTAGG - Intronic
1075409830 10:122219216-122219238 GGGGGGAGTGCAGTGAGGGTGGG - Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075798853 10:125139991-125140013 AGGGACAGTTCAGCAAGGGTTGG - Intronic
1076784510 10:132743190-132743212 GGGCTGAGTGCAGCGCTGGTGGG - Intronic
1076784529 10:132743248-132743270 GGGCTGAGTGCAGCGCTGGTGGG - Intronic
1076784548 10:132743306-132743328 GGGCTGAGTGCAGCGCTGGTGGG - Intronic
1076784567 10:132743365-132743387 GGGCTGAGTGCAGCGCTGGTGGG - Intronic
1076784585 10:132743424-132743446 GGGCTGAGTGCAGCGCTGGTGGG - Intronic
1078244718 11:9563618-9563640 AGGGCAAGTGCAGCTATTGTGGG - Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079587072 11:22139421-22139443 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1082835947 11:57650073-57650095 AGGGACAAGGCGGCGATGGTGGG + Intronic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1085119474 11:73957930-73957952 AGGGAGAGTGCAGCGAGGCCCGG + Intronic
1085194851 11:74662957-74662979 AGGGAGAGTGCAGCAACTGTGGG - Intronic
1085259186 11:75194521-75194543 GGGGAGAGATCAGCGAGGGTGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087404907 11:97718074-97718096 AGGCTGAGTGCCGCGATGGTGGG - Intergenic
1088110324 11:106253378-106253400 AGGGAGAGTGCAGGACTGGTGGG - Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088629605 11:111761970-111761992 AGGTAAAGTACAGAGATGGTAGG + Intronic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090227340 11:125079657-125079679 AGGGAGAGAGAAGGGAGGGTGGG - Intronic
1090932599 11:131311764-131311786 AGGGAGAGTGGACCGAGGGTTGG + Intergenic
1091050107 11:132359951-132359973 AGGCAGTGTGCAGAGAAGGTAGG - Intergenic
1093047099 12:14459472-14459494 ATGAAGAATGCAGCGATGTTTGG + Intronic
1093798300 12:23340222-23340244 AAGGAGAGTGCACCAGTGGTGGG - Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095250401 12:39972460-39972482 AGGGAGATTGCAGATTTGGTGGG - Intronic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096191872 12:49624526-49624548 AGGGAGAGTGATGAGATGGCAGG + Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099713782 12:86264703-86264725 CCGGAGAGTGCAGAGATGCTTGG - Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1103063215 12:117875608-117875630 AGGGAGAAGGCAGCGATTATGGG - Intronic
1104568470 12:129904531-129904553 AGGGAGAGCGCAAGGATGGCTGG + Intergenic
1105040334 12:132956217-132956239 AGGGAGCGTGCAGCGGGGGCGGG - Intronic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108074630 13:46667017-46667039 AGGGAAAGTGAAGAGCTGGTTGG + Intronic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113909986 13:113837114-113837136 AGGGATAGAGCAGTGATGGGAGG + Intronic
1116218550 14:42052601-42052623 AGGGTGAGGGCTGCTATGGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116522210 14:45863378-45863400 AGGGATGGTGGAGAGATGGTGGG + Intergenic
1117285996 14:54286353-54286375 AGGCAGAGTTCAGCCAGGGTGGG - Intergenic
1119323193 14:73743589-73743611 AGGGACAGGGCAGCGGGGGTGGG - Intronic
1122115880 14:99526997-99527019 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1124631403 15:31339666-31339688 CGGGAGAGTGCAGCACTGGGTGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128290755 15:66476692-66476714 AGGCAGAGGGCAGCCATGGCAGG + Intronic
1129030751 15:72616017-72616039 AGGGAGAATGCAGCAACTGTGGG - Intergenic
1129835661 15:78703818-78703840 AGGGAGAATGCAGCAACTGTGGG - Intronic
1130511674 15:84594818-84594840 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1131302986 15:91216122-91216144 GGGGCGAGTGCAGCAATTGTTGG + Intronic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1133769859 16:8861574-8861596 CGGGAGAGTGCAGCAATGTCTGG - Intronic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1134239389 16:12494249-12494271 AGGGAGGACGCAGAGATGGTGGG - Intronic
1136554084 16:30997583-30997605 AGAGAGGGCGCAGCGATGGGCGG + Intronic
1136922410 16:34343974-34343996 AGGGAGTGTGCAGTGGTGGGGGG - Intergenic
1136982163 16:35067832-35067854 AGGGAGTGTGCAGTGGTGGGGGG + Intergenic
1137384988 16:48033183-48033205 AGGGAGAGGGCGGAGATGGGTGG + Intergenic
1138746862 16:59373348-59373370 AGGGAGAGAGGATCGATGGAAGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1139613738 16:68076578-68076600 AGGGAGGGAGCGGTGATGGTGGG + Intronic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1141815670 16:86407977-86407999 AGGGAAACTGCAGGGAAGGTGGG + Intergenic
1143164540 17:4891429-4891451 AGGGAGAGACCAGGGAGGGTGGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143643649 17:8215136-8215158 AGGGAGCAGGCAGAGATGGTTGG + Intergenic
1144404474 17:14939502-14939524 AGGGAGAGGGGAGCGACGGAGGG + Intergenic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146686552 17:34845168-34845190 ATGCAGAGTGCAGTGATGCTAGG - Intergenic
1147379243 17:40043446-40043468 AGGGACAGTCCAGGGGTGGTGGG + Intronic
1148177985 17:45584515-45584537 AGGGGGAGGGCAGAGAAGGTGGG + Intergenic
1148251940 17:46089478-46089500 TGGGAGATTGGAGGGATGGTGGG - Intronic
1148368538 17:47075231-47075253 TGGGAGATTGCAGGGATGGTGGG - Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149572542 17:57683643-57683665 AGGGAGAGTGGGGGGCTGGTGGG + Exonic
1151816879 17:76475509-76475531 AGGGAGAGTGAACAGCTGGTGGG - Intronic
1152362967 17:79840837-79840859 AGCGAGAGTGGAGCGAGGGATGG + Intergenic
1152630021 17:81406715-81406737 CGGGAGAATCCAGGGATGGTGGG + Intronic
1152776332 17:82204275-82204297 TGGGAGAGTGCTGAGATGGTCGG - Intronic
1152873558 17:82772645-82772667 AGGGAGTGTGCAGCAGTGTTTGG + Intronic
1153970809 18:10225422-10225444 AGGGTCAATGCAGCGACGGTTGG - Intergenic
1155071516 18:22320987-22321009 AGGGAGAGTTAAGAGATGGGAGG + Intergenic
1155433676 18:25788211-25788233 AGGGCGAGGGGAGAGATGGTCGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155679311 18:28470198-28470220 AGGGAGAGTGCTGAGATGAGTGG - Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1162739575 19:12766304-12766326 AGGGAGAGTGGAGCTAGGGGCGG + Intronic
1163600742 19:18247815-18247837 AGGGAGGGTGCAGAGAGTGTGGG - Intronic
1164411118 19:28006263-28006285 AGGGAGAGAGAAGAGATGGCCGG - Intergenic
1164736226 19:30543470-30543492 AGGCAGAGTCCAGCCTTGGTTGG + Intronic
1165065318 19:33225300-33225322 AGGAAGAGTCCAGCGGTGGAGGG + Intronic
1167471921 19:49680221-49680243 AGAGAGACTGGAGAGATGGTAGG + Intronic
1168274448 19:55269401-55269423 AGGGTGAATGCGGCGAGGGTGGG - Intronic
1168448961 19:56448178-56448200 AGGAAGAATGGAGTGATGGTGGG + Intronic
1168682492 19:58326431-58326453 ATGGAAACTGCAGCTATGGTAGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925905630 2:8538255-8538277 AGGGAGAGAGGAGAGAGGGTGGG - Intergenic
926218479 2:10919969-10919991 AGGGAGACTGAAGCGAAGGAGGG - Intergenic
927915336 2:26932333-26932355 AGGGTGAATGCAAGGATGGTGGG - Intronic
928026188 2:27741252-27741274 AGGGAGACTGCAGGGAGGGAGGG - Intergenic
928495741 2:31829723-31829745 AGGGAGAGTGCTGCAATTGGAGG - Intergenic
928545055 2:32321965-32321987 AGGGACAGTGCAGCGGCAGTGGG - Intergenic
929042293 2:37757060-37757082 AGGGATAGTGCAGAGTTGGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930588326 2:53296919-53296941 ATGGAGAGTACAAGGATGGTTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
934603172 2:95673948-95673970 GGGGAGGGTGCAGCAAGGGTGGG + Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
940839229 2:158559853-158559875 AGGGCCAGTACAGGGATGGTGGG - Intronic
941016739 2:160366061-160366083 AGGGAGAGTGCTGGGAGGGATGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941159878 2:162024071-162024093 AGGATGAGAGCAGGGATGGTAGG + Intronic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942653323 2:178191225-178191247 AGTGAGAGTACAAAGATGGTTGG + Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
947103279 2:226644437-226644459 AGGGAGGCTGCAGAGATGGGAGG - Intergenic
948603088 2:239118469-239118491 GAGGAGAGTGCAGCGGTGGGTGG + Intronic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168803859 20:661826-661848 AGGGAGGCTGCAGGGATGGTGGG - Exonic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170675581 20:18477757-18477779 GGGGTGAGGGCAGGGATGGTAGG + Intronic
1171767867 20:29300249-29300271 AGGGAGAGAGCAGCGCGGGGCGG + Intergenic
1171882907 20:30631359-30631381 AGAGAGAGTGCAGGGCTGGCAGG + Intergenic
1172667918 20:36613629-36613651 AGTGCGAGTGCAGAGAAGGTGGG - Exonic
1172919848 20:38472447-38472469 AGGAAGAGTGCTGTAATGGTGGG + Intergenic
1173294882 20:41747774-41747796 TGGGAGAGGGCAGGGAAGGTGGG + Intergenic
1173521788 20:43705377-43705399 AGGGAGAGGACGGCGAAGGTTGG - Intronic
1174695409 20:52551828-52551850 AGGCAGAGTGCAGTGATGATGGG - Intergenic
1175483249 20:59326546-59326568 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175483314 20:59326811-59326833 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1175954045 20:62599312-62599334 AGGGAGTGTGCAGGGCTGGAAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1177014997 21:15775752-15775774 AGGCAGAGTGCAGCGGGGGCGGG - Intronic
1177105068 21:16945487-16945509 AGGAAGAGTGCAGAGACCGTGGG + Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178330360 21:31685322-31685344 AGGGAGAGTGAAGCGGTAATAGG - Intronic
1179293977 21:40044170-40044192 AGGGTGTGTGCTGAGATGGTGGG + Exonic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1179792104 21:43761690-43761712 AGGGTGGGTGCAGGGCTGGTGGG + Exonic
1180245387 21:46543865-46543887 AGAGAGAATGCAGCCATGCTTGG - Intronic
1184421577 22:44385461-44385483 AGGGGGAGTGCAGCCACTGTGGG - Intergenic
1184654286 22:45933360-45933382 AGGGAGCGGGCAGCGTGGGTAGG - Intronic
1203294488 22_KI270736v1_random:28551-28573 AGGGATAGTGCAGAGTTGATGGG + Intergenic
949661361 3:6283176-6283198 AGGCTGAGTGAAGCGATGGCAGG + Intergenic
950433786 3:12966976-12966998 AGGGAGAGCGGAGAGTTGGTGGG - Intronic
950624097 3:14231624-14231646 AGGGAGGGTGGAGAGTTGGTTGG - Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952670954 3:35967671-35967693 GGAGGGAGTGCAGCAATGGTTGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953821333 3:46209878-46209900 AGGAAGGGTGCATCGAGGGTGGG + Intronic
953948616 3:47170335-47170357 AGGATGAGTGGAGTGATGGTTGG + Intergenic
955211154 3:56942497-56942519 AGGGAGAGAGATGGGATGGTTGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
959306834 3:104677980-104678002 AGGGAGAGTGAAGAGATAGTGGG + Intergenic
959716769 3:109442442-109442464 AGGGAGACTGCAGCAATTGTGGG + Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
960802687 3:121555307-121555329 AGAGAGAGTGCATGGGTGGTGGG + Intergenic
960862915 3:122169500-122169522 AGGGAGAGTGCAGCAATTATGGG - Intergenic
962483214 3:135815812-135815834 AGGGAGAATGCAGTGATCATGGG + Intergenic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963468455 3:145711570-145711592 AGGGAGAGTACAGACATGGAGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
969060652 4:4431714-4431736 AGGGAGGGTGCACAGAAGGTGGG - Intronic
969474101 4:7411502-7411524 AGGGAGAGAGGAGCAAAGGTGGG - Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971135976 4:23869000-23869022 ATGGAGGGTGCAGAGATGGCAGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
981827248 4:148957296-148957318 AGGGAGAGTAGAGCTGTGGTTGG + Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
983455508 4:167958268-167958290 AGAGAGAGTGAGGCGAGGGTAGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984496283 4:180501678-180501700 AGGAAGAATGCAGTGATAGTTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
986231480 5:5868194-5868216 GGGGAGAGTGAAGGGATGGATGG - Intergenic
986548242 5:8923625-8923647 AGGAAGAGTGCAGGGACTGTGGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987869147 5:23590263-23590285 AGAAAGAGTGAAGCAATGGTTGG - Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993256985 5:85604471-85604493 AGGGAGGGAGCAGTGACGGTGGG + Intergenic
994310750 5:98267706-98267728 AGGAAAAGTGCAGCGGTTGTGGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
995241122 5:109885984-109886006 AGGGAGAGTGGAGAGACGATGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
995931885 5:117455756-117455778 AGGGAGAGTGCAGCGCGCCTAGG - Intergenic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
997725143 5:136114042-136114064 AGGGTGAGGGCAGGGATGGAGGG - Intergenic
998981464 5:147707611-147707633 AGGGAGAGTGTACCAATGCTAGG - Intronic
999328159 5:150656379-150656401 GGGGAGAGAGCAGAGAGGGTGGG - Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000794459 5:165647565-165647587 AGGAAGAGAGCAGGGATGGGAGG + Intergenic
1001278311 5:170366865-170366887 GGGGAGAGTGCAGAGATGAAGGG - Intronic
1001845255 5:174916445-174916467 AGGGAGAATGCAGCAACTGTGGG + Intergenic
1002097218 5:176838673-176838695 AGGGAGAGTGTAGAGATGTTAGG - Intronic
1003507356 6:6751000-6751022 AGGGAGCGTGGAGAGAAGGTGGG - Intergenic
1005522061 6:26610357-26610379 AGGGACAGTGCAGACTTGGTGGG + Intergenic
1005622603 6:27634092-27634114 AGGGTGAGGGCTGCTATGGTGGG - Intergenic
1006297367 6:33175819-33175841 AGGGATAGTGTAGTGATGGGAGG + Intronic
1006435154 6:34022222-34022244 AGGGAGAGGGGAGCAATGGCTGG + Exonic
1006831678 6:36971861-36971883 AGGTAGGGAGCAGCGATGGCTGG - Intronic
1007001767 6:38320078-38320100 GGGGAGAGTGCTGCGATTGTGGG - Intronic
1007266424 6:40599734-40599756 ACGGAGAGTTAAGCGACGGTGGG - Intergenic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008238792 6:49083692-49083714 ATGAAGAGTGCAGTGATGGTGGG + Intergenic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009403903 6:63289750-63289772 AGGGAGATTGAAGAGATGTTTGG + Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1011102965 6:83744386-83744408 AGGGAGAGGGCAGCAATGGGGGG - Intergenic
1011705853 6:90000943-90000965 AGGAAGAGTGGAGGGATGTTTGG - Intronic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012783124 6:103589062-103589084 AGGGAAAGCGCAGCAATAGTGGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014275609 6:119384876-119384898 AGGAAGAGTGCAGCGACTGCGGG - Intergenic
1014573702 6:123044158-123044180 AGGAAGAGTGCAGCCAAGATGGG - Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017865000 6:158435485-158435507 AGGGAGATGACAGCGATGGGAGG - Intronic
1019326255 7:439742-439764 AGGGGGATGGCAGCAATGGTCGG + Intergenic
1019738562 7:2661992-2662014 AGGGAGCGTGCCGGGATAGTGGG - Exonic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021383398 7:19996959-19996981 ACTGAGACTGCAGTGATGGTTGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1026356065 7:69558554-69558576 TGGGGGAGTGCAGCAAAGGTAGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028299657 7:89181496-89181518 AGGGAGACTGCAGGGACCGTGGG - Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029435842 7:100563653-100563675 AGGGAGAGGGCAGGGTTGTTTGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033631185 7:143159598-143159620 AGGGAGAGTGCCTCTGTGGTAGG + Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035249197 7:157585929-157585951 TGGGACAGTGCAAAGATGGTCGG - Intronic
1038754546 8:30328392-30328414 AGGGAAAGTGCAGAGATCCTAGG - Intergenic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1040318753 8:46278587-46278609 AGGGTCACTGGAGCGATGGTTGG + Intergenic
1040703331 8:50094118-50094140 TGGGAGTGTGCAGGGAGGGTAGG + Intronic
1042804418 8:72756253-72756275 AGGGATAGAGCAGCAATGGCAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043804497 8:84654572-84654594 AGGGAAAGAGCAGTGGTGGTAGG - Intronic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044313771 8:90726531-90726553 AGGGAGACTGCAGTGTTGGGAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045773600 8:105774994-105775016 AGGGAGAGTGAAGGGCTGGGTGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048628513 8:136214120-136214142 AGGGAGAGAGCTGCGATATTTGG - Intergenic
1049279561 8:141737405-141737427 AGGGAGAGTGCAGGAATGAAAGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057895508 9:98905528-98905550 AGGGAGGGTGCAGCGAAGGAGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060119577 9:120975633-120975655 AGGCAGAGTGGAGGGTTGGTGGG - Intronic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060954584 9:127629468-127629490 AGGGAGAGAGCAGCAGTGTTGGG + Intronic
1061036845 9:128118883-128118905 ATGGAGGGTGCAGGGATGGAAGG + Intergenic
1061036867 9:128118946-128118968 ATGGAGGGTGCAGGGATGGAAGG + Intergenic
1061230891 9:129315340-129315362 AGAGAGAGAGGAGGGATGGTGGG - Intergenic
1061509164 9:131049956-131049978 AGGGAAAGGGCAGAGCTGGTCGG - Intronic
1062201379 9:135304568-135304590 AGGGTGAGTGGAGGGATGGAGGG + Intergenic
1062221637 9:135419251-135419273 AGGGAGAGGGCAGTGGTGGGTGG - Intergenic
1062395738 9:136351907-136351929 ATGGGGACTGCAGCGAGGGTGGG + Intronic
1062425362 9:136503711-136503733 GGGGTGGGTGCAGCGGTGGTGGG + Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188715521 X:33455711-33455733 AGGGAGAGTGCAGCAATTCTGGG + Intergenic
1189250767 X:39599368-39599390 AGGGTGAGTGTAGGGTTGGTGGG - Intergenic
1189298875 X:39937847-39937869 AAGGAGTGTGCAGCTATGGAAGG + Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190266551 X:48830671-48830693 AGGGAGAGGGCACTGAGGGTCGG - Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1190440129 X:50468992-50469014 AGGGAGAGTGCAGAGAAAGCAGG + Intronic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1196215746 X:113050049-113050071 AGGGAGAATGCAGCAATTGTGGG + Intergenic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197898457 X:131342361-131342383 AGGAAGAGGGCAGAGAAGGTGGG + Intronic
1197953034 X:131918400-131918422 AGGGAGAGTGCAGCAACTGTGGG + Intergenic
1198274123 X:135085525-135085547 AGGGAGAGTGTAGTTATAGTGGG - Intergenic
1198278062 X:135116200-135116222 AGGGAGAGTGCAGCAAGTGGGGG - Intergenic
1198292900 X:135256316-135256338 AGGGAGAGTGCAGCAAGTGGGGG + Intronic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1198964946 X:142217431-142217453 AGGGAGATTCCAGTGATGGTAGG + Intergenic
1199428828 X:147735594-147735616 AGGGAGACTGGAGCAATGGGAGG - Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic