ID: 1107757801

View in Genome Browser
Species Human (GRCh38)
Location 13:43644396-43644418
Sequence CATAAATTGTTAGATGCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107757801_1107757802 -5 Left 1107757801 13:43644396-43644418 CCATTAGCATCTAACAATTTATG 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1107757802 13:43644414-43644436 TTATGAGCTTTTGATATCCATGG 0: 1
1: 0
2: 0
3: 16
4: 184
1107757801_1107757803 -4 Left 1107757801 13:43644396-43644418 CCATTAGCATCTAACAATTTATG 0: 1
1: 0
2: 0
3: 11
4: 195
Right 1107757803 13:43644415-43644437 TATGAGCTTTTGATATCCATGGG 0: 1
1: 0
2: 1
3: 13
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107757801 Original CRISPR CATAAATTGTTAGATGCTAA TGG (reversed) Intronic
905216781 1:36414233-36414255 TAAAAATTGTTAGATACTCACGG + Intergenic
910242147 1:85098960-85098982 CTTAAATTCATACATGCTAAGGG - Intronic
916569184 1:166009861-166009883 CAAGAATTGCTAGATGCAAAGGG - Intergenic
916732975 1:167582839-167582861 CATAAATGACTAGATTCTAAGGG - Intergenic
917073713 1:171181229-171181251 AATAAATTGGTAGTTGCCAAGGG + Intergenic
917688362 1:177441793-177441815 CATATATTGTTATATACTCAGGG - Intergenic
921998656 1:221450374-221450396 AATAAATTTTAAGATGGTAAAGG - Intergenic
922079487 1:222281340-222281362 TATAAATTGTTATATTATAAAGG + Intergenic
923180858 1:231518142-231518164 TAGAAATTTTTAAATGCTAATGG - Intergenic
923258869 1:232247203-232247225 CAAAAATTGTGAGATGCTCTGGG - Intergenic
923749181 1:236731293-236731315 CCTAAAATGTTGGATGCTGAAGG + Exonic
924066799 1:240232010-240232032 CATAAATGTTAAGATGCTCATGG - Intronic
1063787204 10:9399376-9399398 CATAAATTATCAGATGTTACTGG + Intergenic
1063836746 10:10023442-10023464 CATCAATTGCAAGATGCTAATGG + Intergenic
1065684030 10:28265901-28265923 CATAAGTACTTACATGCTAAGGG + Intronic
1066268863 10:33802544-33802566 CATAATTTGTTAGAAGTTGACGG + Intergenic
1066518582 10:36191283-36191305 CATTAATTGAGAGAGGCTAACGG + Intergenic
1067907063 10:50303491-50303513 CATAAATTGTTCAAAACTAAAGG + Intergenic
1073437817 10:103531829-103531851 CATAAATTATTAGATCTAAAGGG - Intronic
1074138774 10:110652577-110652599 ACTAAAATGTAAGATGCTAAAGG - Intronic
1074232415 10:111550593-111550615 CATAAATGGCTAAATGCCAAGGG + Intergenic
1075642901 10:124077740-124077762 CATTAATTGTGAGATGCCACCGG - Intronic
1076660010 10:132049454-132049476 AATAAATTGTAAGATGCCCAAGG - Intergenic
1077754402 11:5010327-5010349 TGTAAAATGTTAGATGTTAATGG + Intergenic
1078420072 11:11203774-11203796 ATAAAATTGTTAGATGTTAAAGG - Intergenic
1079744676 11:24109567-24109589 CACTAATTATTAGTTGCTAAGGG - Intergenic
1086233880 11:84603474-84603496 CATAAAGTTTTAGATGTGAAAGG + Intronic
1086267985 11:85025417-85025439 CATATATTAATAGATGCTAATGG + Intronic
1086502511 11:87467848-87467870 CAGATATTGTCAGATGGTAATGG + Intergenic
1087021801 11:93610631-93610653 TATAAATTGCTAAATGCTAATGG - Intergenic
1087947774 11:104185219-104185241 TTTAAATTGTTAATTGCTAATGG - Intergenic
1088291667 11:108245303-108245325 CATCAATACTTAGATACTAAGGG + Intronic
1090682162 11:129072671-129072693 GATAAATTGCTAGAGGCTCAGGG + Intronic
1093824613 12:23668701-23668723 CATAAATTTTTAAAAGCTAGGGG + Intronic
1095361261 12:41342954-41342976 CATTAATTGTTGGATACTTAGGG - Intronic
1098725009 12:73952744-73952766 AACAAATTGTTAAATGCAAAAGG - Intergenic
1098764181 12:74465141-74465163 CATAAAGTGTTTGATACAAATGG - Intergenic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099971080 12:89501877-89501899 CAGAAGTTTTTAAATGCTAAAGG + Intronic
1100001220 12:89837863-89837885 CTTAAATTTTTAGATTTTAATGG + Intergenic
1100611064 12:96192925-96192947 CATCAACTGTGAGCTGCTAAAGG - Intergenic
1100806335 12:98287960-98287982 CATAAATCATTAGATTTTAAAGG + Intergenic
1101256287 12:102980085-102980107 CAAAACTTGTAAGATGCTAACGG + Intergenic
1102566222 12:113799067-113799089 GATCAAATGTTAAATGCTAAAGG - Intergenic
1103365318 12:120378093-120378115 CATTAATGGTTTGATGCAAATGG - Intergenic
1107042285 13:35961683-35961705 CATAACTTCCTTGATGCTAAAGG + Intronic
1107206720 13:37799278-37799300 CATGCATTGCTAGAGGCTAAGGG - Intronic
1107368466 13:39713246-39713268 CATAAATTGTTTGTTTCTAATGG + Intronic
1107757801 13:43644396-43644418 CATAAATTGTTAGATGCTAATGG - Intronic
1109756311 13:66764928-66764950 CTTAAATTGTATGATGATAATGG - Intronic
1112668861 13:101612029-101612051 CTTAAATTGTTATATTCCAAAGG - Intronic
1115280669 14:31658976-31658998 TATTAAGTGTCAGATGCTAAAGG + Intronic
1116001736 14:39250080-39250102 CTAAACTTGTTAGATCCTAAAGG + Intronic
1116130987 14:40855474-40855496 CATACAATGTTAAATGTTAAGGG + Intergenic
1116132333 14:40871974-40871996 CTTAAATTGTTACATAATAATGG + Intergenic
1117581030 14:57151890-57151912 GATAGATAGATAGATGCTAAAGG + Intergenic
1117743636 14:58845135-58845157 CATAAATAGATAGCTGCAAATGG + Intergenic
1118866596 14:69709124-69709146 CATGAATTATTAGCTGCTTAGGG + Intronic
1119134923 14:72208687-72208709 CATAACTTGTTCAATGCTACTGG + Intronic
1120349492 14:83335628-83335650 TATAAATGGTTAGATGTTACTGG - Intergenic
1125148528 15:36503154-36503176 CATAAATGTTAGGATGCTAAAGG + Intergenic
1125156024 15:36586881-36586903 CATAGAATGTTAGAAGCCAAAGG + Intronic
1126255468 15:46619932-46619954 CATCCATTGTTAGATGGAAATGG + Intergenic
1130712436 15:86296604-86296626 CATCCATTGTCAGATGCTGATGG - Intronic
1134979714 16:18597366-18597388 CCTAAATATTTAGATGCTACAGG + Intergenic
1139184379 16:64788243-64788265 CATATATTGCTAGATGTAAAAGG - Intergenic
1139401706 16:66687091-66687113 AATAAATTTGTTGATGCTAATGG - Intronic
1139971132 16:70775921-70775943 CATAAATTGGTAGAACCTAAAGG - Intronic
1148993782 17:51689765-51689787 AATAAATTTTAAAATGCTAAAGG - Intronic
1153094878 18:1389486-1389508 CATATATTATTAGATACTATAGG + Intergenic
1153789211 18:8562603-8562625 CAAAAATTGTTGGAAGCTAGAGG + Intergenic
1156123720 18:33877599-33877621 CATAAAATGACAGAGGCTAAAGG - Intronic
1157219302 18:45814637-45814659 CATAAAGTGTTAGAGGTTGAAGG + Intergenic
1157939194 18:51908370-51908392 AATAAATTGTTAGCTGAAAATGG + Intergenic
1158040067 18:53082284-53082306 CAAAAATTGTTATATGGTTATGG + Intronic
1166019360 19:40011740-40011762 CATAAATTGTTGGATTCAAATGG - Intronic
1167965567 19:53143188-53143210 GATAAATTGTTAAAAGCTATAGG + Intronic
1168514896 19:57003005-57003027 CAGAAATTGTAAGAAGGTAATGG + Intergenic
1168587485 19:57605200-57605222 CAGAAATTGGTAGCAGCTAAGGG - Intronic
928639836 2:33286567-33286589 CCTACATTATTATATGCTAAAGG + Intronic
928914925 2:36460352-36460374 CATAAATTAGTGGTTGCTAAGGG + Intronic
929307126 2:40376219-40376241 TGTACATTGTTAGATGCTTAAGG - Intronic
931077469 2:58732637-58732659 AACACATTGTTAGATGCTTAGGG + Intergenic
931190135 2:59992312-59992334 TGGAGATTGTTAGATGCTAATGG - Intergenic
932722890 2:74150807-74150829 CATAAATTGATAGTTGTAAAAGG - Intergenic
933006073 2:76997153-76997175 CATAAATTGATAGTTGCTGGGGG - Intronic
933623252 2:84569246-84569268 GATATATTGTTAGATGAAAAAGG + Intronic
936892019 2:117382360-117382382 GATAAATTGGAAGTTGCTAAAGG - Intergenic
938555436 2:132419065-132419087 CATTAATTGTTAAAAGCTTAGGG + Intronic
938680442 2:133684377-133684399 AATGAATTGTTATTTGCTAAAGG - Intergenic
939241430 2:139565815-139565837 AATTAATTGTTAGTTGATAAAGG + Intergenic
939664940 2:144939951-144939973 AAGAAATTGATAGATGCCAAAGG + Intergenic
940256244 2:151733294-151733316 CATATATTGTTGCAGGCTAAAGG + Intronic
940440937 2:153715472-153715494 CTTTAAATGGTAGATGCTAATGG + Intergenic
941200930 2:162509228-162509250 CATGAGTTATGAGATGCTAAAGG + Intronic
941783550 2:169475142-169475164 CACAAATTGTTGGAGGCCAAGGG - Intergenic
943607182 2:189989595-189989617 CATAAAATGTTAAATTTTAAAGG + Intronic
945310152 2:208302529-208302551 AATAAAATGTTTGATTCTAATGG - Intronic
1168843597 20:926281-926303 CATAAATTGTTATGTGATATTGG + Intergenic
1171966843 20:31536874-31536896 CATGTATTGTTAGGTGGTAATGG - Intronic
1172586843 20:36091704-36091726 CCTCCTTTGTTAGATGCTAAAGG - Intronic
1173329712 20:42064848-42064870 CATCACTTGTTAGATTCTACAGG - Intergenic
1174915732 20:54651794-54651816 TATAAATTGTTTAGTGCTAATGG + Intergenic
1177220630 21:18187812-18187834 CAAAAATGTTTATATGCTAATGG - Intronic
1177492799 21:21849151-21849173 TATATATTGTTTGATCCTAATGG + Intergenic
1178055774 21:28796881-28796903 TATTAATTGTTATATCCTAAAGG - Intergenic
1185090546 22:48767790-48767812 GATGAATGGTTAGATGCTAAAGG - Intronic
949199011 3:1348972-1348994 TAAAAAGTGTTAGATGTTAAAGG - Intronic
950271387 3:11618728-11618750 CATTAAATTTTACATGCTAATGG - Intronic
956334385 3:68146831-68146853 CATTGTTTATTAGATGCTAAAGG + Intronic
957171923 3:76748735-76748757 CATAAACTGTTACATTTTAAAGG + Intronic
957962437 3:87274203-87274225 CATAAATGGTTATATGCTTCAGG + Intronic
958555515 3:95670813-95670835 CATAACCTGGTAAATGCTAAGGG + Intergenic
959204918 3:103294670-103294692 CAGAAATTGCTAGATGTTAGAGG - Intergenic
962739954 3:138356320-138356342 CATAAATGGTCAGCTCCTAAAGG - Intronic
963667761 3:148211255-148211277 CATAAATTGTCAAATGATGAAGG - Intergenic
963817266 3:149845469-149845491 CATAGATTGTTAGGAGGTAATGG + Intronic
963882434 3:150543904-150543926 TAAAACTTTTTAGATGCTAAAGG + Exonic
963937871 3:151073125-151073147 CATAAAGTATTGGTTGCTAAAGG - Intergenic
963961777 3:151317362-151317384 AATAAATTGTTTTATGTTAAAGG - Intronic
963969934 3:151418710-151418732 CATAAATTATTAATTGCAAAGGG - Intronic
964350828 3:155802145-155802167 CATAAATTATTGAGTGCTAAGGG + Intronic
964451694 3:156818593-156818615 CATTAAGTGGTAGATTCTAAGGG + Intergenic
965902713 3:173662750-173662772 CACAAATTGGGAGATGCTACTGG + Intronic
966483319 3:180437445-180437467 CATAAATTTTAATATGATAAAGG + Intergenic
967360253 3:188622596-188622618 CATATATTTTCAGATGCCAAAGG + Intronic
972117411 4:35654306-35654328 CATAAAATATTAGCTTCTAAAGG + Intergenic
973183120 4:47292553-47292575 CATAAATTGTTTTAAGCTCAGGG - Intronic
973946580 4:55962591-55962613 CATTAATTGCTAGATCCAAAAGG + Intronic
974732439 4:65885717-65885739 CAGAACTTATTAGATGTTAAAGG - Intergenic
976665064 4:87581469-87581491 CCTGAATTGTTTTATGCTAAAGG - Intergenic
978251405 4:106635647-106635669 CATAAATTCTTATATGTTTAGGG + Intergenic
978427216 4:108595145-108595167 CATGAATTGCTAGATGAAAAGGG + Intergenic
979772102 4:124539337-124539359 CATAAATTTTTAGTTGGAAAAGG + Intergenic
980921000 4:139085277-139085299 CATAAATTGTTTGAAACAAAGGG + Intronic
980934245 4:139211280-139211302 CAATAAATGTTAGGTGCTAAGGG - Intergenic
982095682 4:151920649-151920671 AATAAATTGGTAAATGCAAAGGG - Intergenic
982348089 4:154383975-154383997 AACAAATTGTTAAATGCTCATGG - Intronic
982383950 4:154780543-154780565 CATAAATAGTTGGTTCCTAAAGG + Intergenic
982907764 4:161098180-161098202 CATAAATGGCTAAATGCTAGTGG + Intergenic
983722641 4:170875470-170875492 CATAAATTGTTTCATGCCAACGG - Intergenic
984672136 4:182502809-182502831 ATTAAATTGTGGGATGCTAAGGG + Intronic
986115836 5:4773492-4773514 CATAAATGGTTATATGCACAGGG - Intergenic
986186260 5:5443453-5443475 AATAAATTGTCATATGTTAAAGG + Intronic
986467098 5:8036693-8036715 CCTATATTGTAAGATGGTAATGG + Intergenic
990257740 5:53988475-53988497 CATTAAATGTTAGCTTCTAAAGG + Intronic
991382748 5:66048774-66048796 CAAAAAAGGTTAGATGTTAAAGG + Exonic
993077337 5:83250406-83250428 TATAAATTCTTAAATACTAATGG - Intronic
993146780 5:84103884-84103906 TATAAATTGTTCTATGATAAAGG + Intronic
994977210 5:106824538-106824560 CAGAAAATGTTAAATACTAAGGG + Intergenic
996538656 5:124605985-124606007 GATAAATTTTTACATGTTAAAGG + Intergenic
997430466 5:133835841-133835863 CAAAAATTGTTAGACTCAAAAGG - Intergenic
1000173503 5:158727407-158727429 CAGAAATTCTGAGATGCTGATGG - Intronic
1004273922 6:14219159-14219181 CAGAAATTGTGAGATAATAAAGG - Intergenic
1004653318 6:17633506-17633528 CTTAACTTGTAAGATGCTCATGG + Intronic
1005252636 6:23964798-23964820 CAAAAAGTGTGAGTTGCTAAAGG - Intergenic
1005312190 6:24569536-24569558 CAGAAAATGTTAGATGATATGGG + Intronic
1007140325 6:39566737-39566759 AATAAATTGGTATATGCCAAGGG + Intronic
1007151488 6:39696943-39696965 AAAAAATTGTTAGATGCCACAGG + Intronic
1009575449 6:65451438-65451460 GAAGAATTATTAGATGCTAAAGG - Intronic
1010149194 6:72710492-72710514 GATAAATTATTACATGCCAATGG + Intronic
1010535269 6:77020114-77020136 TATAAATTATTTGATGATAATGG - Intergenic
1011191554 6:84735023-84735045 CACAATTTGTTAGATACTTAGGG - Exonic
1011731905 6:90273475-90273497 CATTAAGTGTTAAATGGTAATGG + Intronic
1013044013 6:106465665-106465687 CATAAAATCTTAGATACTAGAGG - Intergenic
1013506911 6:110809825-110809847 CATAAATTACTAGCTGCAAAAGG - Intronic
1013523828 6:110956581-110956603 CATAAATTGTCAGATTTTGAGGG - Intergenic
1013935144 6:115585585-115585607 CAGATATTGATAAATGCTAAGGG - Intergenic
1014989766 6:128059515-128059537 CATAAATTGGTACAACCTAAGGG - Intronic
1022675983 7:32499198-32499220 CATAAATTATTTCATGCCAAAGG - Intronic
1022839176 7:34146457-34146479 AATAAAATGTAATATGCTAAGGG + Intronic
1026585270 7:71650994-71651016 GGTAAATTGTTAGAAGTTAAAGG + Intronic
1027472120 7:78586373-78586395 AATAAATTCTTAGATGTTATGGG - Intronic
1028313045 7:89362924-89362946 CCTAATGTGTTAGATGCTGATGG + Intergenic
1028977191 7:96927095-96927117 CTTAAATTGCTAGGGGCTAAGGG - Intergenic
1030329003 7:108253151-108253173 CATGAAGTTTTAGATGCTAGGGG + Intronic
1030919037 7:115357013-115357035 CATGAATTATTTGATGCTAGAGG + Intergenic
1034328683 7:150262701-150262723 CATAAAATGTTAGATGTAGATGG - Intronic
1034764532 7:153706687-153706709 CATAAAATGTTAGATGTAGATGG + Intergenic
1035140698 7:156757662-156757684 AATAAATTGTGAGGAGCTAATGG + Intronic
1035951401 8:4025415-4025437 CATAAATTATTAAATAATAATGG - Intronic
1035971194 8:4251213-4251235 CATATATTGTTAGCTGTTATAGG - Intronic
1038105393 8:24428242-24428264 AAAAAAATGTTAGATGTTAATGG - Intergenic
1038977801 8:32720444-32720466 CATCAATACTTAGATTCTAAAGG - Intronic
1042578602 8:70250958-70250980 CATAAATAGTAAGATAGTAAGGG + Intronic
1044123063 8:88422157-88422179 CATAAACAATTATATGCTAAGGG - Intergenic
1046614162 8:116457575-116457597 TCTAAATGATTAGATGCTAAGGG - Intergenic
1050579887 9:7042489-7042511 CACAAATTGTTATATGCTGTCGG + Intronic
1058633648 9:107015550-107015572 CATAAATTTTTAAATTCTGAAGG - Intergenic
1186022796 X:5275278-5275300 TATATATTGTTAGGTTCTAAAGG - Intergenic
1186660291 X:11662588-11662610 CATTAATTATGAGATGCTAATGG + Intronic
1186695803 X:12030587-12030609 AATAAATTGTTAGATGCCTGTGG - Intergenic
1187683329 X:21791230-21791252 GATAACTTATTAAATGCTAATGG - Intergenic
1187854713 X:23625726-23625748 GATAAATTATTTGATGATAAGGG - Intergenic
1189339326 X:40192640-40192662 CATAATTTGTTACATGACAATGG + Intergenic
1189567910 X:42262386-42262408 CATAAATTTTTGGTTACTAAGGG - Intergenic
1190373816 X:49768754-49768776 CATTATTTGGTAAATGCTAAGGG + Intergenic
1194879474 X:99233906-99233928 CAAAAATTGTTAGATGGGAAAGG - Intergenic
1196084216 X:111667068-111667090 CATAAGTTATTATATGATAAAGG - Intronic
1196831404 X:119778628-119778650 AATAGATTGTGAGATCCTAAGGG + Intergenic
1197165744 X:123375683-123375705 CACATATTGCTAGATTCTAAGGG - Intronic
1197842563 X:130764294-130764316 CTTAAATTTTAAGATGCTCATGG + Intronic
1199025667 X:142934613-142934635 CATCAATTGATAGTTGCAAAAGG + Intergenic
1199548278 X:149031109-149031131 CATAAAGTGTTAAAAGTTAAAGG - Intergenic
1200341279 X:155399280-155399302 CATAAAAGGTTAGAGGCCAAAGG - Intergenic
1202334272 Y:23790325-23790347 CATAGGTTGTTTAATGCTAAGGG + Intergenic
1202536496 Y:25879734-25879756 CATAGGTTGTTTAATGCTAAGGG - Intergenic