ID: 1107759715

View in Genome Browser
Species Human (GRCh38)
Location 13:43664985-43665007
Sequence CACAAAATCTCCTGCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107759700_1107759715 27 Left 1107759700 13:43664935-43664957 CCAATGCTATCAGTTGGCCATAG 0: 1
1: 0
2: 1
3: 5
4: 58
Right 1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 105
1107759702_1107759715 10 Left 1107759702 13:43664952-43664974 CCATAGGACAGCCTGCAGCCCCA 0: 1
1: 0
2: 1
3: 20
4: 231
Right 1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 105
1107759705_1107759715 -8 Left 1107759705 13:43664970-43664992 CCCCACCCCCAGGAACACAAAAT 0: 1
1: 0
2: 5
3: 46
4: 537
Right 1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 105
1107759707_1107759715 -10 Left 1107759707 13:43664972-43664994 CCACCCCCAGGAACACAAAATCT 0: 1
1: 0
2: 3
3: 33
4: 359
Right 1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 105
1107759704_1107759715 -1 Left 1107759704 13:43664963-43664985 CCTGCAGCCCCACCCCCAGGAAC 0: 1
1: 0
2: 9
3: 81
4: 810
Right 1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 105
1107759706_1107759715 -9 Left 1107759706 13:43664971-43664993 CCCACCCCCAGGAACACAAAATC 0: 1
1: 0
2: 3
3: 36
4: 360
Right 1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107759715 Original CRISPR CACAAAATCTCCTGCGGGGC TGG Intronic
900470248 1:2850152-2850174 CACAGATTCACCTGCAGGGCGGG - Intergenic
902374243 1:16022841-16022863 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
902379194 1:16044718-16044740 CCCAAAGTCTCCTGGGTGGCAGG + Intronic
903188562 1:21643261-21643283 CAGAAAATCCCCTCCGAGGCTGG + Intronic
904918234 1:33985696-33985718 CACAAGATCTACTGGGGAGCAGG - Intronic
905028423 1:34866251-34866273 CAAAGAAGCCCCTGCGGGGCCGG - Exonic
917855932 1:179099662-179099684 CACATACACACCTGCGGGGCGGG + Exonic
922888215 1:229036929-229036951 CTCACAATCTCTTGTGGGGCAGG - Intergenic
923310994 1:232735276-232735298 CACAAAAACTCCTCTGGGGCCGG - Intergenic
1066538999 10:36423835-36423857 AACAAACTCTCCTGCTGGCCTGG - Intergenic
1067166710 10:43871137-43871159 CCCCAAGTCTCCAGCGGGGCCGG - Intergenic
1070552523 10:77501858-77501880 ATCAAAATGTCCTGTGGGGCAGG + Intronic
1072618367 10:97064270-97064292 CACATCATCTCCTGCTGGGCAGG - Intronic
1072792163 10:98326122-98326144 AACAAAATCATCTGCCGGGCTGG - Intergenic
1076816525 10:132917802-132917824 CACACAACCTGCTGTGGGGCAGG - Intronic
1077094508 11:793609-793631 CACAGCAGCTCCTGTGGGGCAGG + Exonic
1078150896 11:8758898-8758920 CACAAAACCTCCTGGACGGCTGG + Intronic
1083413671 11:62511550-62511572 TAAAAAATCTACTGCTGGGCCGG - Intronic
1083638206 11:64131620-64131642 CAGAAAACATCCTGAGGGGCTGG - Intronic
1083864627 11:65446772-65446794 CAGAAAATCCCCTCCGGAGCTGG + Intergenic
1090220686 11:125021078-125021100 CATAAAATCGCCTGGGGGGAAGG + Intronic
1094178576 12:27566953-27566975 CACAAAATTGCCTTTGGGGCAGG - Intronic
1098711758 12:73771730-73771752 GAGAAAGTCTCCTGCGTGGCTGG + Intergenic
1104747897 12:131221445-131221467 CACACAGTCCCCTGCGCGGCTGG + Intergenic
1107759715 13:43664985-43665007 CACAAAATCTCCTGCGGGGCTGG + Intronic
1110250054 13:73371328-73371350 CACAAAATGTCCTGTGGGACTGG - Intergenic
1112188357 13:97149958-97149980 CACAAAATCACCTGAGGGTCAGG + Intergenic
1115532173 14:34337549-34337571 TTCCAAATCTCCTGAGGGGCTGG - Intronic
1115863022 14:37710963-37710985 CACAGAATCACCTTCAGGGCTGG + Intronic
1120747987 14:88168829-88168851 CACACTATCTTCTGCAGGGCTGG - Intergenic
1121236429 14:92394488-92394510 CTCAAACTCTCCTGCGTGGCTGG - Intronic
1121267765 14:92615490-92615512 CAGATAACCTCCTGCAGGGCCGG - Intronic
1122863824 14:104594628-104594650 CACCAAGTCTCCTAGGGGGCGGG + Intronic
1129518330 15:76170540-76170562 CTCTAACTCTCCAGCGGGGCAGG - Intronic
1129896860 15:79114841-79114863 TACAAGATCTCCTGCTAGGCCGG - Intergenic
1131188685 15:90295433-90295455 CACACAAGCTCTTGGGGGGCTGG - Intronic
1131553455 15:93377284-93377306 CACAAAAACTACAGAGGGGCAGG - Intergenic
1132184676 15:99792685-99792707 CCCACAAGCTCCTGGGGGGCTGG - Intergenic
1132432307 15:101771969-101771991 CCCACAAGCTCCTGGGGGGCTGG + Intergenic
1132845680 16:1999852-1999874 CTCAGAAGCTCCTGCAGGGCCGG + Exonic
1133580137 16:7136870-7136892 CACAAAATCTACTGCATGCCTGG + Intronic
1134585142 16:15403849-15403871 CAAAAAATCTCCAGATGGGCTGG - Intronic
1136356128 16:29745733-29745755 CACGGAATCTGCTGCCGGGCCGG + Intronic
1140779684 16:78283152-78283174 CCCAGATTCTCCTGCCGGGCTGG - Intronic
1143434622 17:6914461-6914483 CACAAACTCTTCTGCGCAGCGGG + Intronic
1145199433 17:20929226-20929248 GACAGAAGCTCCTGCTGGGCTGG - Intergenic
1146146833 17:30426315-30426337 CTCCAATTCTCCTGCGTGGCTGG - Intronic
1158553175 18:58454298-58454320 CACAAAACTTCCTCTGGGGCTGG - Intergenic
1160782725 19:884998-885020 CACAAAAGCACCTGCGGGGGAGG + Exonic
1160947537 19:1650716-1650738 CACCAAATTTCCCTCGGGGCGGG - Intronic
1161529035 19:4776005-4776027 CACATGATCTCCTGCGAGGTTGG + Intergenic
1163050952 19:14683142-14683164 CACAAGATTTGCTGGGGGGCAGG + Intronic
1163586564 19:18167555-18167577 CACAAAAATTCCTGCTGGGCTGG + Intronic
1168666741 19:58210103-58210125 CACAGCATCTCCTGTGAGGCAGG + Intronic
925979549 2:9165765-9165787 CACAGAATCTCCAGAAGGGCTGG - Intergenic
927327107 2:21817780-21817802 GTCAAAATCTCCTGGAGGGCTGG - Intergenic
927784603 2:25964984-25965006 CACAATCTCTCCTGCGGGCTGGG + Intronic
933414861 2:81974466-81974488 CAAAAAAACTCCTGTGAGGCAGG + Intergenic
934552788 2:95272405-95272427 CACAAAATCGCCTAAGCGGCAGG + Intergenic
936032130 2:109080912-109080934 CACAAAACCTCCAGGAGGGCTGG + Intergenic
941619696 2:167762735-167762757 CACCAAATTTCCTGAGAGGCTGG + Intergenic
1171343119 20:24445911-24445933 CACAAAGTCTTCTGGAGGGCAGG - Intergenic
1172777615 20:37416576-37416598 CCCACAAACTCCTACGGGGCAGG + Intergenic
1176077644 20:63255495-63255517 CATAAAATCTCGAGTGGGGCAGG - Intronic
1178407082 21:32333922-32333944 AACATAATCTCCTTGGGGGCAGG + Intronic
1183829132 22:40408762-40408784 CACCAAAGCTCCTGGGGTGCCGG - Intronic
1183845019 22:40535855-40535877 CTCAATATCTCCTGTGGTGCTGG - Intronic
952341994 3:32454741-32454763 CACAAGATCTCCTTGGGGACAGG - Exonic
954336276 3:49919805-49919827 CATAAAATCTACTGTGGGACTGG + Intronic
956040551 3:65140648-65140670 CACAAAATCTGCTGTGAGCCAGG - Intergenic
967808661 3:193736872-193736894 CATACACTCTCCTGCGGGACTGG + Intergenic
967949452 3:194829594-194829616 CTAAAAAACTGCTGCGGGGCCGG + Intergenic
970810249 4:20084739-20084761 CCTAAAAGCTCCTGTGGGGCAGG + Intergenic
973300164 4:48573036-48573058 CATAAGATCTTCTGCGGGGAGGG + Intronic
974277737 4:59747879-59747901 TCCTAAATCACCTGCGGGGCTGG + Intergenic
975555760 4:75663380-75663402 CGCTAAATCTCCTGAGTGGCTGG + Intronic
984770241 4:183430898-183430920 CAAGAAATCTCCTGCCTGGCAGG - Intergenic
986543235 5:8869361-8869383 CACAAAGTCTCCTACCTGGCTGG - Intergenic
991699747 5:69306221-69306243 AACAAAATCTTTTGAGGGGCTGG - Intronic
995662579 5:114501423-114501445 CACATAATCTCCCACTGGGCAGG - Intergenic
997366602 5:133329327-133329349 CACAAAAACTTCTGCTGGCCTGG + Intronic
999112272 5:149132032-149132054 CACAAAATCCCCTCCTCGGCTGG - Intergenic
999202642 5:149826971-149826993 CACGGAGTCCCCTGCGGGGCTGG - Intronic
1005690098 6:28296697-28296719 TACAAAATGCCCTGAGGGGCTGG + Intronic
1007947058 6:45836277-45836299 CACAGAATCACCTGGAGGGCTGG + Intergenic
1017914283 6:158819387-158819409 CCCAAAAGCCCCGGCGGGGCGGG + Exonic
1020875937 7:13693852-13693874 CACAAACTCTGCTGAGGGGTGGG - Intergenic
1021935213 7:25624089-25624111 CAGAAAATCTTCTCCAGGGCAGG - Intergenic
1024373192 7:48609712-48609734 CACAAAATTTCCTGTATGGCTGG - Intronic
1029606698 7:101603219-101603241 CACAGAAGCTCCCACGGGGCTGG + Intergenic
1037522710 8:19695805-19695827 TACAAAATCTCCTGCGCTGAAGG - Intronic
1040016229 8:42702430-42702452 CAAAATATTTCCTGTGGGGCTGG - Intronic
1043424531 8:80135427-80135449 CTCTAACTCTCCTGGGGGGCAGG - Intronic
1045435712 8:102161843-102161865 CACAAAATCTGCTCCAGGTCTGG + Intergenic
1047460352 8:125057974-125057996 ATCAGAATCACCTGCGGGGCTGG - Intronic
1051091013 9:13408205-13408227 CACATAATCTCTTACGGGGGAGG - Intergenic
1057347570 9:94264569-94264591 CACAAAAACTCTTACAGGGCAGG + Intronic
1058931998 9:109729800-109729822 GACAAAGTGTCCTCCGGGGCAGG - Intronic
1060385661 9:123225745-123225767 CACAGAATCTCTTGGAGGGCTGG - Intronic
1060750512 9:126165493-126165515 CACAGAGTCCCCTGCTGGGCAGG + Intergenic
1061419225 9:130464264-130464286 CACAGAATCTCCTCCGTGGCAGG + Intronic
1061859482 9:133460523-133460545 CACAAAAGCCCCTGGGGAGCGGG - Intronic
1062578370 9:137218873-137218895 CACAGACTTTCCTGCTGGGCTGG - Intergenic
1062611139 9:137374022-137374044 TCCCAAATCTCCTGCGGGTCAGG - Intronic
1062729856 9:138102827-138102849 CACACAGCCTCCTGGGGGGCGGG - Intronic
1192430569 X:71108804-71108826 CACAACAGCTCCTGTGAGGCAGG + Intronic
1192807271 X:74521938-74521960 CACACATTCTTCTGCAGGGCTGG - Intronic
1195032074 X:100936055-100936077 CACAAAATCACCAGCTGGACTGG - Intergenic
1198005993 X:132493184-132493206 CACAAATACTGCTGTGGGGCTGG - Intergenic
1200183208 X:154164181-154164203 CAAAAAATATCCTTCAGGGCCGG + Intergenic
1200188862 X:154201295-154201317 CAAAAAATATCCTTCAGGGCCGG + Intergenic
1200194513 X:154238436-154238458 CAAAAAATATCCTTCAGGGCCGG + Intergenic
1200200267 X:154276239-154276261 CAAAAAATATCCTTCAGGGCCGG + Intronic
1200906850 Y:8492484-8492506 CACAATATCACCTGTGGGGAGGG - Intergenic