ID: 1107761945

View in Genome Browser
Species Human (GRCh38)
Location 13:43688792-43688814
Sequence GAACTCAGCTTGTCTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107761945 Original CRISPR GAACTCAGCTTGTCTAAAAC TGG (reversed) Intronic
903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG + Intergenic
906946307 1:50297292-50297314 GATATCAGCCTGGCTAAAACTGG + Intergenic
909900769 1:81131870-81131892 GAATTGTGCTTTTCTAAAACTGG + Intergenic
910723379 1:90312260-90312282 GAACTCAGCTTCTTGGAAACTGG + Intergenic
917809335 1:178642319-178642341 GAAATTAGCATGTCTAAACCCGG + Intergenic
918298288 1:183178633-183178655 GAACTCAGCTTTTCTAGGGCTGG - Intergenic
918350805 1:183653786-183653808 GAACAAATCTTGTCTTAAACTGG - Intronic
923584356 1:235253028-235253050 GAAAACATCTTGTATAAAACAGG + Intronic
1069462280 10:68606835-68606857 GAACTCATTTTGTCATAAACTGG + Intronic
1071008737 10:80913013-80913035 GAAGTGAGCTTGTCTAAATAGGG + Intergenic
1078076104 11:8162277-8162299 AAAGTCAGCTTGACTAAGACAGG - Intronic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085984744 11:81771993-81772015 GAAGTGAACTTCTCTAAAACAGG + Intergenic
1088326958 11:108610500-108610522 AAAATCAGCTTATCTAAAAAAGG - Intergenic
1093019327 12:14188550-14188572 GAACTCAGCTTTTAAAAAGCAGG + Intergenic
1093350143 12:18089691-18089713 GAACTCATCTGCTCTGAAACTGG - Intronic
1095921845 12:47539649-47539671 GAGCTCAGCATATCTAAAATCGG - Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107527399 13:41246862-41246884 GAACTCAGATAGCCTAAGACTGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG + Intronic
1123797817 15:23791120-23791142 GAAGTCAGTGTGTCTGAAACTGG - Intergenic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1133657643 16:7881548-7881570 GACCTCACCTTCTCCAAAACTGG + Intergenic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1140597347 16:76431912-76431934 GAACTCAATGTGTCAAAAACAGG - Intronic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1146109235 17:30072986-30073008 GAACTCCCATTGTCTAAAACTGG - Intronic
1150788457 17:68181108-68181130 GAACCCAGTGTGTCTAAAATCGG - Intergenic
1151741209 17:75983497-75983519 AAACACTGGTTGTCTAAAACAGG - Intronic
1156320181 18:36013246-36013268 GAACTCTGCTTGTCTAATGTTGG - Intronic
1157058791 18:44262103-44262125 CAAGGCATCTTGTCTAAAACAGG + Intergenic
1160306651 18:77746281-77746303 GTCCTCAGCTTGTATAAAAAAGG + Intergenic
1161657362 19:5524490-5524512 GGACTCAGCTTGTCTTCAGCAGG - Intergenic
1162855049 19:13461667-13461689 GAACTCAGGCTTTCTAAATCGGG - Intronic
1163251330 19:16127957-16127979 CATCTGAGCTTGCCTAAAACAGG - Intronic
1167114651 19:47481799-47481821 GAACACAGATGGTCTAGAACAGG - Intronic
1168574642 19:57499913-57499935 GAACTCAGCTTGCCGGAAGCTGG + Intronic
930732853 2:54744746-54744768 AAACTCAGCATGTCTGAAATAGG - Intronic
935534374 2:104276605-104276627 AATCTCAGCATCTCTAAAACTGG + Intergenic
941708384 2:168684699-168684721 GATCTCAGCTTCTCAAAACCAGG + Intronic
943018239 2:182540710-182540732 GTACACAGTTTGTCGAAAACTGG + Intergenic
948158094 2:235800864-235800886 GAAGTCAGATGGTTTAAAACAGG - Intronic
1170205249 20:13791139-13791161 AAACTCAACATATCTAAAACAGG - Intronic
1179137368 21:38691936-38691958 GAACTCAGCTGGCCAAAAGCTGG + Intergenic
1179503730 21:41825820-41825842 GTGCTCAGGTTGTCTTAAACTGG - Intronic
1179511776 21:41878697-41878719 GGACTCAGCTTCTCTAAACGCGG + Exonic
1181903653 22:26175739-26175761 GAACTCACATTGTATAAAATTGG + Intronic
949201617 3:1387272-1387294 CAGCCCAGCCTGTCTAAAACTGG - Intronic
949416507 3:3820655-3820677 GAACAAAGCCTGTCTGAAACAGG - Intronic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
952752828 3:36839316-36839338 GAAAGCTGCTTTTCTAAAACAGG + Intronic
957050861 3:75410868-75410890 AAACGCTGGTTGTCTAAAACGGG + Intergenic
957498325 3:81020150-81020172 GAAATCAGCTTGGCATAAACAGG - Intergenic
959558726 3:107754294-107754316 GAATTCAGCATGTCTAGAAAAGG + Intronic
961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG + Intergenic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
966212706 3:177469544-177469566 GAAGTCTGCTTTTCTAAGACAGG + Intergenic
969821582 4:9724825-9724847 AAACGCTGGTTGTCTAAAACGGG - Intergenic
985288132 4:188357952-188357974 TAACTCACCTTGCCTGAAACAGG - Intergenic
987029477 5:13962795-13962817 GAACCCAGCTAGTCAAAAAGAGG + Intergenic
988108975 5:26790253-26790275 GAATGCAGTTTGTTTAAAACGGG - Intergenic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
1000340450 5:160273331-160273353 GAACACAGCTTCTCTAACAGAGG + Intronic
1000970518 5:167709206-167709228 GAACTCAGCTTGGAAAAGACAGG - Intronic
1001295562 5:170496382-170496404 GAACTCAGCTGGTCTGACTCCGG - Intronic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1010122900 6:72399750-72399772 CAACTCTGCTTGTGTAAAACAGG + Intronic
1011977641 6:93325003-93325025 GAACCTACCTTTTCTAAAACTGG + Intronic
1013191756 6:107809704-107809726 GAACTCAACGTTTCCAAAACTGG - Intronic
1016034115 6:139368182-139368204 GAATTCAGCTTGGCTAAATCAGG - Intergenic
1020317168 7:6914035-6914057 AAACGCTGGTTGTCTAAAACGGG + Intergenic
1022262741 7:28722124-28722146 TAAATCAGCCTGTTTAAAACTGG + Intronic
1025168943 7:56738645-56738667 GAACTCATTTTGTCATAAACTGG - Intergenic
1025703445 7:63841249-63841271 GAACTCATTTTGTCATAAACTGG + Intergenic
1034910239 7:154990901-154990923 GAAAATAGCTTCTCTAAAACTGG + Intronic
1038191160 8:25322440-25322462 GAACTCAGTATGGCTAAAGCAGG + Intronic
1038228787 8:25681637-25681659 GAACTCAGGATGCCTGAAACTGG + Intergenic
1043823795 8:84900891-84900913 GAACTCAGCTCTGCTGAAACAGG + Intronic
1043910197 8:85855136-85855158 GAACTCCCCTTGTCTAGATCTGG - Intergenic
1043913397 8:85891232-85891254 GGACTCTGCTTGTTTAAAAAAGG + Intergenic
1044278194 8:90326415-90326437 AAACTCAACATGTCTAAAAATGG + Intergenic
1044624070 8:94218858-94218880 GAACCCTGTTTGTCTAAAAACGG + Intergenic
1047040121 8:120984263-120984285 GAACTCAGCTGGTCTGTTACGGG - Intergenic
1047710151 8:127543558-127543580 GAATTCAGCTGGTCTAACACAGG + Intergenic
1048218171 8:132515795-132515817 GAATTAATCTTGTCTGAAACGGG - Intergenic
1048298284 8:133232543-133232565 AAACCCAGCTTCTCTAAAGCAGG + Intergenic
1050287076 9:4114667-4114689 GACCTCAGCTAGTCAGAAACCGG - Intronic
1060245355 9:121941455-121941477 AAAGTCAACCTGTCTAAAACTGG + Intronic
1061902334 9:133679297-133679319 GAACTCAGCTGGTCTCTGACTGG + Intronic
1062561473 9:137144120-137144142 GAGCTCAGCTTGTCCAAAGGTGG + Intronic
1188126740 X:26377566-26377588 TAACTCAAATGGTCTAAAACGGG + Intergenic
1189475368 X:41349378-41349400 GAACGCAGCTTGTCTAGGAAGGG + Exonic
1193511979 X:82413510-82413532 GAACACAGCATGTCCAAAAATGG - Intergenic
1195466649 X:105186513-105186535 GAAGTCAGCCTGTCTAGAGCAGG + Intronic
1196748843 X:119096440-119096462 GAACTCATCTTTTCTTATACAGG + Intronic
1198389612 X:136161082-136161104 GAACCCAGCCTGTCTATATCTGG - Intronic
1199416983 X:147596745-147596767 GAAGGCAGCATGCCTAAAACTGG + Intergenic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1201932254 Y:19363662-19363684 GCTCTCAGCTTGTCTATTACTGG - Intergenic