ID: 1107762146

View in Genome Browser
Species Human (GRCh38)
Location 13:43691285-43691307
Sequence ATGGGCACCCGGACTAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107762146 Original CRISPR ATGGGCACCCGGACTAAGAT AGG (reversed) Intronic
903473074 1:23600818-23600840 ATGGCAGCCTGGACTAAGATGGG - Intronic
917293792 1:173497631-173497653 ATGGTCAAACTGACTAAGATTGG + Intergenic
1084403541 11:68958450-68958472 CTGGGCATCCGGGCAAAGATGGG - Intergenic
1085416128 11:76320186-76320208 ATGGGGACCCAGAGGAAGATGGG - Intergenic
1089675969 11:120089585-120089607 ATGGTGACCCAAACTAAGATTGG - Intergenic
1101420381 12:104545935-104545957 ATGGGCACGGAGACTGAGATGGG - Intronic
1104218982 12:126763584-126763606 ATGGGCACTGGGACTAACACAGG - Intergenic
1107762146 13:43691285-43691307 ATGGGCACCCGGACTAAGATAGG - Intronic
1121598134 14:95181518-95181540 AAGGGCAGCAGGAGTAAGATGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1126317261 15:47383394-47383416 ATGGGCACAAGCACTATGATTGG + Intronic
1131295842 15:91148466-91148488 GGGGGAACCCAGACTAAGATGGG - Intronic
1131513231 15:93061111-93061133 ATGGACGCCAGGACGAAGATGGG - Intronic
1133057289 16:3151961-3151983 CTCGGCACCCGGACTAAACTCGG - Intergenic
1136067356 16:27768101-27768123 ATGGGCACGTGGCCTGAGATGGG + Intronic
1136187226 16:28595582-28595604 AAGGGCACCCGCATGAAGATGGG + Exonic
1136189705 16:28608510-28608532 AAGGGCACCCGCATGAAGATGGG + Exonic
1136317278 16:29461709-29461731 AAGGGCACCCGTACGTAGATGGG - Exonic
1136431853 16:30201052-30201074 AAGGGCACCCGTACGTAGATGGG - Exonic
1137997741 16:53237284-53237306 GTGGGCACCTGGTCTAAGAGAGG - Intronic
1138350079 16:56341796-56341818 ATGGGCACCCGAGCTATGCTGGG - Intronic
1141455114 16:84136159-84136181 GTGGGCACCTGAACTAAGGTGGG - Intronic
1148401370 17:47364613-47364635 ATGTGAACTTGGACTAAGATAGG - Intronic
1149506762 17:57200828-57200850 ATGGTCACCGTGACTGAGATGGG - Intergenic
1156262267 18:35456455-35456477 ATGGGGACCAGGACCGAGATAGG + Intronic
1164760668 19:30726189-30726211 GTGGGAACCCAAACTAAGATAGG + Intergenic
926859938 2:17299072-17299094 ATGGTCACCCTGGCTATGATGGG - Intergenic
933189881 2:79322751-79322773 ATGGGGACTGGGACTAAAATAGG + Intronic
946031778 2:216711055-216711077 AGGGGCAGCGGGACTAAGCTAGG + Intergenic
955407670 3:58635767-58635789 AAGGGCACCAGGACTGGGATGGG - Intronic
958743673 3:98107770-98107792 ATGGCCAACCAAACTAAGATTGG - Intergenic
960156471 3:114301647-114301669 CTGGGCACCTGGACTAACTTTGG + Intronic
962245936 3:133792986-133793008 ATGGTCAAACGGATTAAGATTGG + Intronic
969588633 4:8108869-8108891 ATGGGAACCCAGACCAAGACAGG - Intronic
969728650 4:8940333-8940355 ATGGGCACCCGGACTACTGCAGG + Intergenic
979217596 4:118183882-118183904 AAGGGCACCTTGACTAAGTTTGG + Intronic
994117093 5:96073052-96073074 AAGTGCTCCTGGACTAAGATAGG - Intergenic
1001934311 5:175693728-175693750 GTCTGCACCCGGACCAAGATGGG - Intergenic
1016640255 6:146340295-146340317 ATGGGCACTAGTACCAAGATAGG - Intronic
1023373369 7:39533301-39533323 ATGGGCACCAGGAATAACATGGG + Intergenic
1051896644 9:21995186-21995208 ATGGGCGCCCGGACCCAGCTGGG - Intronic
1185866871 X:3631865-3631887 CTGGTCTCCCGGACTAAGAGAGG + Intronic
1187782078 X:22838391-22838413 ACGGGCCCCTGGACTAACATAGG - Intergenic
1197722566 X:129755239-129755261 ATGGGCCCCTGGACTAGGCTGGG - Intronic