ID: 1107770313

View in Genome Browser
Species Human (GRCh38)
Location 13:43781966-43781988
Sequence AGCAATCATCCCATTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107770313 Original CRISPR AGCAATCATCCCATTTGGGT GGG Intronic
900821483 1:4892778-4892800 GGGAATCATCCCATGTGGTTGGG - Intergenic
907451239 1:54547266-54547288 AGGAATCTTCCCAGTGGGGTTGG + Intronic
908824495 1:68120176-68120198 AGAAATCATCTCATTCAGGTGGG + Intronic
909248911 1:73327234-73327256 AACTATCAGCCCATGTGGGTAGG + Intergenic
914224005 1:145705385-145705407 AGAAATCATCTCATTTGGGCTGG - Intronic
916458341 1:164994241-164994263 TGAAATCAATCCATTTGGGTTGG + Intergenic
918675234 1:187276373-187276395 AACAACCAGTCCATTTGGGTTGG + Intergenic
921612197 1:217225810-217225832 AGGAATCCTCCCGTTTTGGTTGG + Intergenic
1063188871 10:3675056-3675078 AGTAAGCATCACATTTGGGCAGG - Intergenic
1063532158 10:6844001-6844023 TGCATTCATCCCTTTTGGGATGG - Intergenic
1064300329 10:14117583-14117605 AGCAATGCTGCCATTTGGTTGGG - Intronic
1065124530 10:22561676-22561698 AGCAATCCTCCCATGTAGCTGGG + Intronic
1066384609 10:34931527-34931549 TCCAATCATGCCCTTTGGGTTGG - Intergenic
1066447698 10:35498655-35498677 GGCATTCTTCCCATCTGGGTAGG + Intronic
1066680110 10:37929993-37930015 AGCACTAATCCCATTTGTGAGGG + Intergenic
1069915843 10:71786240-71786262 AGCAAACAGTCCCTTTGGGTTGG + Intronic
1070345937 10:75541896-75541918 AGCCAACATCCCCTTTGGCTTGG - Intronic
1072073817 10:91948490-91948512 AGCAATCCTCCCATCTTGCTAGG + Intronic
1072270983 10:93776218-93776240 AGAAATCATCTCATTTTGTTTGG + Intronic
1073333305 10:102685588-102685610 AGCAAGCTTCCCCTTTGGGAGGG - Intronic
1073815070 10:107197483-107197505 AGCACTCATACCCTTTGGGAAGG - Intergenic
1075343721 10:121667058-121667080 AGCAACCCTATCATTTGGGTAGG + Intergenic
1077643538 11:3903404-3903426 AGCAACCATCCCAGTTGCTTTGG + Intronic
1077882106 11:6359187-6359209 AGCAATCCTCCCATGTAGCTGGG + Intergenic
1079839242 11:25374748-25374770 TGAGATCATCCCATTTTGGTGGG + Intergenic
1080639958 11:34152811-34152833 GGCAGTCATCCCTGTTGGGTTGG + Intronic
1083480936 11:62946271-62946293 AGCAAGGAGGCCATTTGGGTAGG + Intronic
1083895336 11:65616998-65617020 AGCAATCCACCCAGGTGGGTGGG + Exonic
1089642822 11:119858991-119859013 ATCCATCCTCCCACTTGGGTGGG + Intergenic
1091082587 11:132685560-132685582 AGCAATCATCCTCTTTGGGAAGG + Intronic
1091165949 11:133476290-133476312 CCCAATCAGGCCATTTGGGTCGG - Intronic
1091276738 11:134357858-134357880 AGCAATTATCCCCTCTGGGGTGG + Intronic
1099336412 12:81365319-81365341 AACTATCATCCCATTTAGATGGG - Intronic
1099672676 12:85715140-85715162 AACACTAATCCCATTTGGGAGGG + Intergenic
1100394322 12:94171498-94171520 AACAATCATCCCATTTCTCTGGG - Intronic
1100814983 12:98378262-98378284 AGCAATTTTCCCATTTGAGATGG - Intergenic
1102065559 12:109972118-109972140 AGAAATCATCTCATTTGAATGGG + Intronic
1103763993 12:123269317-123269339 AGAAATCGTCCCATTTTGGCTGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106330147 13:28732489-28732511 AGGAGTCATTCCATTTGGATAGG + Intergenic
1107710240 13:43144319-43144341 GGAAATCATCCCATATGTGTTGG - Intergenic
1107770313 13:43781966-43781988 AGCAATCATCCCATTTGGGTGGG + Intronic
1108840436 13:54606567-54606589 AGCAATCATCCCATTTCATATGG + Intergenic
1108840739 13:54611502-54611524 AGAAGTCATCCCCTCTGGGTAGG - Intergenic
1112005070 13:95246489-95246511 AGCAATTATCAGATTTGGCTTGG + Intronic
1114860147 14:26507215-26507237 AGCAATCATCCCAATTAAGTAGG - Intronic
1115432969 14:33342446-33342468 AGCAATTATGCCATTTGGATAGG + Intronic
1117595370 14:57321660-57321682 ATCAATGATCCCTGTTGGGTTGG - Intergenic
1121902606 14:97707598-97707620 AGAAATGAACCCAGTTGGGTTGG + Intergenic
1122076041 14:99235174-99235196 TGTAATCCTCCCATTTGGGAGGG - Intronic
1123467128 15:20525768-20525790 AGCAGACTTCCCATTTGGGATGG - Intergenic
1123650987 15:22475274-22475296 AGCAGACTTCCCATTTGGGATGG + Intergenic
1123741395 15:23284116-23284138 AGCAGACTTCCCATTTGGGATGG + Intergenic
1123745602 15:23318442-23318464 AGCAGACTTCCCATTTGGGATGG - Intergenic
1124277874 15:28341759-28341781 AGCAGACTTCCCATTTGGGATGG - Intergenic
1124304827 15:28569849-28569871 AGCAGACTTCCCATTTGGGATGG + Intergenic
1124933547 15:34147836-34147858 AGTAAACATCCCTTTTGAGTGGG - Intronic
1125876266 15:43148800-43148822 AGCAACCATACAATTTGGTTTGG + Exonic
1127208190 15:56742415-56742437 AGCAATCCTCTGATTTTGGTGGG - Intronic
1128860075 15:71062480-71062502 AGCAATCCTCCCAAGTGGCTGGG - Intergenic
1130177855 15:81593712-81593734 AGCTCTCATCTCATGTGGGTAGG + Intergenic
1132115828 15:99135898-99135920 ACCAACCATCCCATTTGGGATGG + Intergenic
1135520648 16:23174997-23175019 AGCATTAATCCCATCTTGGTGGG + Intergenic
1135678885 16:24440257-24440279 AGGGATGTTCCCATTTGGGTCGG - Intergenic
1137653797 16:50142677-50142699 AGCAATCCTCCCACCTGGGCTGG - Intergenic
1138007822 16:53354457-53354479 AGCAGACTTCCCATTTGGGATGG - Intergenic
1138837766 16:60459108-60459130 AGCAAGCAACACATTTGGGCAGG - Intergenic
1140152479 16:72383575-72383597 TCCAATCATACCATTGGGGTTGG - Intergenic
1140983573 16:80136142-80136164 TGCAATCAACCCTATTGGGTCGG + Intergenic
1145938295 17:28727460-28727482 AGCAGTCATTCCACGTGGGTGGG + Intronic
1146643726 17:34562519-34562541 AGCAATCCTACCATGTAGGTGGG + Intergenic
1153001535 18:459788-459810 AGCAATCATCTCCTTTGAGATGG - Intronic
1157187275 18:45551472-45551494 AGAACTCAACCCATTTGGGGAGG + Intronic
1158548072 18:58412537-58412559 ACCAAGCATGCAATTTGGGTAGG - Intergenic
1159603655 18:70452610-70452632 AGCAATGGTTCCATTTGGATGGG - Intergenic
1159721884 18:71900200-71900222 AGAAAACAGCCCATTTGGGCTGG - Intergenic
1160071327 18:75630959-75630981 AGTAATCATACCATTTGTGTGGG - Intergenic
1163094810 19:15049351-15049373 ATCACTCATCCCATTGGCGTTGG + Intergenic
1164083113 19:21877741-21877763 AGCCATAATCCCATTTTGGAAGG - Intergenic
925513505 2:4653651-4653673 AGCAATGAGGCCATTGGGGTGGG - Intergenic
927808348 2:26167996-26168018 AACAATCCTCCCAAGTGGGTGGG - Intergenic
927926461 2:27017112-27017134 AGCAAACATCACATTGGGGAGGG - Intronic
928302750 2:30141103-30141125 GGCACTCATCCCATTTGTGAAGG - Intergenic
934091781 2:88556823-88556845 TGAAATCAATCCATTTGGGTTGG - Exonic
938763877 2:134447688-134447710 AGCAGTCATCCCAAGTGGGAGGG + Intronic
1169678873 20:8186967-8186989 AGCCATCACCCCATTTAGGCTGG - Intronic
1170328598 20:15183421-15183443 AGCAATCCTCCCATGTAGGTGGG - Intronic
1172446411 20:34995745-34995767 AGCACTTACCCCATTAGGGTAGG + Intronic
1177698247 21:24601969-24601991 AGCAATATTCTCATTTGGGTTGG + Intergenic
1183867732 22:40717309-40717331 AGCTATCATCTCATGTGTGTTGG - Intergenic
949340305 3:3022298-3022320 AGCAATCCTCCCATCAAGGTAGG - Intronic
952703934 3:36357504-36357526 AGTCATCACCCCATTTGGATTGG - Intergenic
953251080 3:41246280-41246302 TGCCATCATCCCATTTAGATGGG + Intronic
956366905 3:68514102-68514124 AGCACTAATCCCATTTGCGAGGG + Intronic
960249852 3:115439805-115439827 ACCAATCATCCTATTTGTATGGG + Intergenic
963560665 3:146861019-146861041 AACAATCATCACATTTTGGATGG - Intergenic
969196215 4:5565984-5566006 AGCATTCATCCCAGTGGGGGAGG - Intronic
970205582 4:13652573-13652595 AGGAATCATCCCTTTGGGGAGGG + Intergenic
970703396 4:18770407-18770429 AGCACTAATCCCATTTGTGAGGG + Intergenic
981831684 4:149009035-149009057 TGCAATCAACTCATTTGGCTTGG + Intergenic
982199101 4:152942830-152942852 ATCAATCCTCCCATATGAGTTGG - Intronic
982244867 4:153341625-153341647 TGCAATCATGTCATTTGGGTAGG - Intergenic
982673288 4:158347808-158347830 TGCATTCATCCCATTTGTCTGGG - Intronic
984621498 4:181957878-181957900 AACTATAATCCCAGTTGGGTGGG - Intergenic
987431091 5:17834065-17834087 ATCAATCATCACCTTTGGGAAGG + Intergenic
987872020 5:23631610-23631632 AGCACTAATCCCATTCTGGTGGG + Intergenic
991191141 5:63875510-63875532 AGCAATAATCCCATTTATGAGGG + Intergenic
992091733 5:73323506-73323528 AGCAATCATTCTATTAGGGTGGG - Intergenic
992671078 5:79061804-79061826 AGCAATCCTCCCAGTTAGCTAGG - Intronic
995765657 5:115614870-115614892 AGAACTCATCACTTTTGGGTAGG + Exonic
997237520 5:132282090-132282112 AGCAATCATTCCAGTTCTGTTGG + Intronic
1004529813 6:16443234-16443256 AGCAATCATACTATTTAGGTAGG - Intronic
1007176019 6:39898208-39898230 AGCAACCTTGCCCTTTGGGTGGG - Intronic
1010250511 6:73702312-73702334 AAAAATCATCCAATTTGGTTTGG + Intronic
1011888380 6:92126261-92126283 AGCAATGATCCCAGTAGAGTGGG - Intergenic
1014665114 6:124228248-124228270 AGCACTAAGCCCATTTGGGAAGG - Intronic
1019782917 7:2954832-2954854 AGAAATTATCTCATTTGGCTGGG + Intronic
1020454993 7:8361750-8361772 TGTAATCATCCCAGTTGGGGGGG - Intergenic
1021683361 7:23157309-23157331 AGCAATCATCCCAGATGAGGTGG + Intronic
1022876094 7:34531953-34531975 AGCACTAATCCCATTTATGTGGG - Intergenic
1023202077 7:37709492-37709514 AGCAATCATGCTCTTTGGGGTGG - Intronic
1026050468 7:66942337-66942359 AGCAATGAACCCATTTGAGATGG - Intronic
1027285002 7:76638527-76638549 CGCAATCTCCCCATTTGGGCTGG + Intergenic
1038230981 8:25699786-25699808 AGCAATCCTCCCATGTAGCTGGG - Intergenic
1039540148 8:38360232-38360254 AGCAATCCTCCCACTTTGGCTGG + Intronic
1040936707 8:52789213-52789235 AGCAAGAATGCCATTTTGGTAGG + Intergenic
1042516237 8:69662431-69662453 AGAAATAATCTCATTTGGGTAGG - Intergenic
1044139039 8:88625499-88625521 AGAATTCTTTCCATTTGGGTTGG + Intergenic
1045194677 8:99918398-99918420 AGCAATCCTCCCATTTCAGCTGG - Intergenic
1045908699 8:107379632-107379654 AGCCATGATCCCGTTTGTGTGGG - Intronic
1047183421 8:122610928-122610950 GGCACTCATCCCATTTGTGAGGG - Intergenic
1051760435 9:20457637-20457659 AGTAAACATTCCTTTTGGGTGGG - Intronic
1057215610 9:93226821-93226843 AGCCATGGTCCCATTTGGATGGG + Intronic
1058240273 9:102548779-102548801 AGCAATTTTCCCATTTGGGATGG + Intergenic
1058247427 9:102645346-102645368 AGCACTGATCCCATTTCTGTGGG - Intergenic
1060714616 9:125912287-125912309 CGTAATCATACCATTTGAGTGGG + Intronic
1185913024 X:4003288-4003310 AGCACTAATCCCATTTGTGAGGG - Intergenic
1196611165 X:117716529-117716551 AGAAATCTTCCCATTTGGGCTGG + Intergenic
1197112620 X:122794568-122794590 AGAAACCATCCCACTTGAGTTGG - Intergenic
1198294877 X:135276888-135276910 AACAATGATAGCATTTGGGTTGG + Intronic