ID: 1107778636

View in Genome Browser
Species Human (GRCh38)
Location 13:43875481-43875503
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 5, 1: 14, 2: 54, 3: 102, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107778634_1107778636 -3 Left 1107778634 13:43875461-43875483 CCTGGATTTAGGGTAGGTGACTG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG 0: 5
1: 14
2: 54
3: 102
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904973914 1:34441508-34441530 CTGAATATGAAAATGAAGGAGGG - Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
906329315 1:44871487-44871509 CTATACATGCAGATGGACAAGGG - Intronic
906338535 1:44956747-44956769 CTGAATAAGCATTTGGAAAAAGG + Intronic
907531062 1:55097511-55097533 CAGAATATGAAAATTGAAAAAGG + Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908151659 1:61309017-61309039 ATGAGTGTGCAAATGGAAAACGG - Intronic
908235488 1:62143813-62143835 CTGAGTGTGCAAGTGGATAATGG + Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
911869875 1:103083481-103083503 TTGAAGATTCAAATGTACAATGG + Intronic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912013642 1:105004882-105004904 CTGCATCTGCATCTGGACAAGGG + Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
913050398 1:115112578-115112600 CTGAATAGGCAAATGCCCAGAGG - Intergenic
913314622 1:117539511-117539533 GTGTACATGCAAATGGAGAAGGG + Intergenic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
916402725 1:164466567-164466589 CTGAATAGGCAAATAAACAGTGG - Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917488862 1:175480155-175480177 CTGACTATGCAGCTGGAGAATGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918610317 1:186482556-186482578 CTTAATATGCTAATAGAGAATGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921809126 1:219491793-219491815 CTAAAAGTGCAAATGGGCAAAGG + Intergenic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922655265 1:227376773-227376795 CTCAATTTGAAAATGGGCAAAGG - Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
924786926 1:247207486-247207508 CTGAATATGGCAATGGAAAGTGG + Intergenic
1063336008 10:5214536-5214558 CTGAATATTCATATGGTCTATGG - Intronic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063729829 10:8683954-8683976 TTGAAAATGCAAATGTACCAAGG + Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067457293 10:46428059-46428081 CTGAAAAAGAAAATGGCCAATGG + Intergenic
1067629909 10:47956579-47956601 CTGAAAAAGAAAATGGCCAATGG - Intergenic
1067958163 10:50816507-50816529 ATGAATATGTCAATGGACACTGG - Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068923543 10:62511253-62511275 CTGAATGTTGAAATGGAGAAAGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070466585 10:76730170-76730192 ATTAATATGCAAATGTATAATGG - Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070933116 10:80274604-80274626 GTGAAGATGGAAATGGACAGCGG + Exonic
1071128410 10:82363170-82363192 CTCAATAGGGAAATTGACAAAGG + Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1074233589 10:111562135-111562157 CTGGAAAGGCAAATGGAGAATGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076409843 10:130239758-130239780 CTACATATGCAAAGGGTCAAAGG - Intergenic
1077779856 11:5315372-5315394 CTGATTCTGCAAGTGGATAATGG + Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1079195584 11:18323526-18323548 CTGGGTCTTCAAATGGACAAAGG - Intronic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1081422998 11:42894295-42894317 CTAAATATGCAAATGGACTGTGG - Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1085560825 11:77472173-77472195 CTGAATAAGCAAATTTACCAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086941003 11:92798541-92798563 ATGAAAATGGAAATGGGCAATGG - Exonic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1088424230 11:109684599-109684621 CTTATTATGGAAATGGATAAGGG + Intergenic
1089016020 11:115166282-115166304 CTGAATATTCAAAGGCACAGAGG + Intergenic
1090723984 11:129505287-129505309 CTGAAGCTGCAAATGCAGAAAGG + Intergenic
1090730618 11:129570500-129570522 ATGAAGATGCAAAGGTACAAGGG - Intergenic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1091938272 12:4450756-4450778 CTGAATCTGCAAAGGGGCAGAGG + Intergenic
1092104949 12:5914689-5914711 CTGAAATTGGAAATGGAGAATGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094001946 12:25705196-25705218 CTGAATATTCAAACAGCCAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095318275 12:40793318-40793340 CTTAATGTGCATATGGACACCGG - Intronic
1095724033 12:45432860-45432882 GGCAATATGTAAATGGACAATGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096612633 12:52813171-52813193 CTGATTTTGCAAATGAAAAAGGG - Intronic
1097365960 12:58712786-58712808 CTGGATTTGCAAGTGGTCAATGG + Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098058709 12:66537010-66537032 ATGAATATGCATATGGACTTTGG + Intronic
1101383273 12:104232979-104233001 CTAAATAGGTAAATGCACAATGG + Intronic
1101693900 12:107106692-107106714 ATCAATATGCACATGGACATGGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104167527 12:126248397-126248419 CTGAAAAAGCAAAAGAACAATGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105106996 13:16551072-16551094 TTGAATCTGCAAGTGGACATTGG + Intergenic
1105356772 13:19665867-19665889 CTGAACCTGCAAATGTACGATGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1111708271 13:91778693-91778715 CAGCAAATGAAAATGGACAAGGG - Intronic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112230442 13:97584192-97584214 CTGAATATCTAAATAGACCATGG - Intergenic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114940317 14:27601688-27601710 CAGGTTATGCAAATGGACCAAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115737266 14:36346641-36346663 CTTGAAATGCAACTGGACAATGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1120062384 14:79999466-79999488 CTGAGTCTTCAAATGGAGAAGGG + Intergenic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1122434548 14:101685632-101685654 CCTGATATGAAAATGGACAAAGG + Intergenic
1202921255 14_KI270723v1_random:32005-32027 CTGGATCTGCAAAGGGACTAGGG + Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124613838 15:31227357-31227379 CTGAATTGGAAAATGGGCAATGG + Intergenic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1126336101 15:47587867-47587889 CTGACAATGCAAATGGAGAAAGG - Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1127187891 15:56498942-56498964 TTAAATATGCAAATGTATAAAGG - Intergenic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131492551 15:92875537-92875559 CTGATTATTTAAATGGGCAAAGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1135422068 16:22312047-22312069 CAGAATAGGCAAATGTACAGAGG + Intronic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135912500 16:26574166-26574188 CTGACTTTGAAAATGGAGAAAGG + Intergenic
1136061197 16:27727650-27727672 CTGAAAATGCAAATGGTCATAGG - Intronic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144060662 17:11581123-11581145 CTGAATATGCAAGCAGACAATGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1144370363 17:14584539-14584561 GTGGAAATGCAATTGGACAAAGG + Intergenic
1144570416 17:16394548-16394570 CACAATAGGAAAATGGACAAAGG + Intergenic
1145183893 17:20777547-20777569 GAAGATATGCAAATGGACAATGG - Intergenic
1145446413 17:23180394-23180416 CAGAATCTGCAAGTGGACATTGG + Intergenic
1145447435 17:23194668-23194690 CAGAATCTGCAAGTGGACATTGG + Intergenic
1146120013 17:30184467-30184489 CTGATTATCCAAATGCAAAAAGG - Intronic
1146402610 17:32511830-32511852 CTGAATAAGCAAATATATAATGG - Intronic
1146611494 17:34309450-34309472 CTGACTTTGAAAATGGAGAAGGG - Intergenic
1146978702 17:37139369-37139391 CTGGAGGTGGAAATGGACAATGG + Intronic
1148086940 17:44999600-44999622 CTGATAATGGAAATGTACAATGG - Intergenic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1149455239 17:56782456-56782478 CAGAATTTGTAAATGGATAAAGG + Intergenic
1150379380 17:64708603-64708625 CCGAACATGGAAATGGACAGAGG + Intergenic
1153536889 18:6111198-6111220 AGGAAGATGCAAATGGATAAGGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156734353 18:40235251-40235273 ATGAATATGCAATAGGCCAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1159899593 18:74033335-74033357 CTTAATAGGAAAATGGGCAAAGG + Intergenic
1160580456 18:79881679-79881701 CTGAATCTGGAGATGGACTATGG - Intronic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1160613057 18:80104043-80104065 CTGAATGTGCCAACAGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1167527278 19:49992686-49992708 CTTAGTAGGAAAATGGACAAAGG - Intronic
1167580642 19:50339834-50339856 CTCATTAGGAAAATGGACAAAGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
1168514329 19:56998363-56998385 CCGAATGTGCAAATGCACAAGGG + Intergenic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
926491894 2:13534039-13534061 CTAAAAATGTAAATGGAAAATGG + Intergenic
926667036 2:15536955-15536977 CTGATTAGGCAAATGGAAACTGG - Intronic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927932621 2:27054941-27054963 CTGAATCTGCAAGTGGAGCAGGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928189105 2:29145260-29145282 CTGAATTTGCAAGTGGGCAGTGG + Exonic
928621883 2:33098265-33098287 CCCAATAGGAAAATGGACAAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
931266314 2:60663426-60663448 CTGAATAGGCAAATAGATAGGGG - Intergenic
931928091 2:67097080-67097102 CTGCATATGCAAAGGGTCAGAGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933623933 2:84576736-84576758 CAGCATATGCAAATTGACAAAGG + Intronic
934891276 2:98071932-98071954 TTAAATGTGCAAATGGACACAGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937389824 2:121475469-121475491 CTGTATCTGCAACTGGACCATGG + Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
938640504 2:133273363-133273385 CCCAATGTGAAAATGGACAAAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939330067 2:140746623-140746645 CTGAATTTGCAAATGCACGCAGG + Intronic
939632550 2:144542950-144542972 CAGAATAGGCAAATTTACAAAGG - Intergenic
939922202 2:148129781-148129803 CTGAATAAGTGAATAGACAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941144055 2:161821059-161821081 GAGAATATCCAAATGGCCAAAGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942496203 2:176542223-176542245 ATGTGTATGCAAATGAACAAAGG - Intergenic
942686664 2:178539844-178539866 CCCAATATGTAAATGGACCAAGG - Exonic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943803464 2:192091419-192091441 CTAAATTTGCAATTGCACAAAGG + Intronic
944090562 2:195905205-195905227 CTGAATATGTAAATTTGCAAAGG - Intronic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
944865960 2:203862052-203862074 CTGAATATTCAAATGTCTAAGGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
945602397 2:211884388-211884410 CTGACTATGAAAATGTACCACGG + Intronic
946026389 2:216674202-216674224 CTCAAGATGCAAAGGGAGAATGG + Exonic
946684045 2:222249391-222249413 CTGAAGATGAAAATGGGAAAAGG - Intronic
946754515 2:222930732-222930754 TTGAAGATGAAAATGGACAAAGG + Exonic
946930871 2:224669099-224669121 CTGAATATGAAACTGGGGAAAGG + Intergenic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176295245 21:5068694-5068716 CTGAATGTGCACATGGACAGCGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176985243 21:15428362-15428384 TTCAATTTTCAAATGGACAAAGG - Intergenic
1177375699 21:20268494-20268516 ATGGATATGCATATGCACAAAGG + Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177571103 21:22888288-22888310 ATTAACATGCATATGGACAAGGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179861804 21:44193434-44193456 CTGAATGTGCACATGGACAGCGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1182008596 22:26981836-26981858 TTGATTATGCCAATGGACACTGG + Intergenic
1183096067 22:35553047-35553069 CTGAATTTGCTAGGGGACAAAGG - Exonic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1184995314 22:48201767-48201789 CTGTATTTGAAAATGGGCAAAGG + Intergenic
949216390 3:1574201-1574223 CAGTATATGCAAAGGCACAAAGG - Intergenic
949354440 3:3163324-3163346 CTGAATATGAAAATAACCAAGGG + Intronic
950104334 3:10378718-10378740 CTGAATGTGGGAAAGGACAAGGG - Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951364778 3:21768179-21768201 TTGATTATGAAAAAGGACAAAGG + Intronic
951604198 3:24414020-24414042 CTGAAAATGCAAATATACTATGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951858356 3:27223421-27223443 TTGGATGTGCAGATGGACAATGG - Intronic
952230209 3:31421519-31421541 TTGAATATGCAAATATGCAAAGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954719759 3:52551444-52551466 CTTTATATGCAAAATGACAAAGG + Intronic
955875289 3:63482805-63482827 ATGAATATGTACATGGATAATGG - Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956396416 3:68831325-68831347 CTAAACATGGAAAGGGACAACGG - Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956843715 3:73163138-73163160 CTGAATTTTAAAATGGACCAAGG - Intergenic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957248765 3:77746117-77746139 CAGAATATCAAAATGGACACTGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
957684696 3:83486643-83486665 CTGAATCTGGAGGTGGACAAGGG + Intergenic
957903033 3:86521701-86521723 CAGAATATGCAAAAAGACTAGGG - Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958184481 3:90102874-90102896 AAGAAAATGCAAATGGACAGAGG + Intergenic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959750951 3:109834362-109834384 TTGAGTATGCAACTTGACAATGG - Intergenic
959872583 3:111345429-111345451 CTGACTTTGAAAATGGAGAAAGG + Intronic
960079851 3:113529908-113529930 CTAAATATGCAAGTGGGCAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
962973941 3:140429839-140429861 CTCCATAGGCAAAGGGACAAAGG + Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963953439 3:151227579-151227601 GTGATTATGCAAATGGATCATGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964501925 3:157357469-157357491 CTTACAATGCAGATGGACAAAGG - Intronic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968773991 4:2528093-2528115 CCCAATTTGAAAATGGACAAAGG + Intronic
969281936 4:6176670-6176692 CTGAACATGCAAAAGGACCCAGG + Intronic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970316764 4:14835460-14835482 CTGACTATCCAAACAGACAATGG + Intergenic
970481558 4:16480783-16480805 CTGAGTATCAAAATGTACAATGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972581382 4:40398509-40398531 CAGCATATGCATATGGTCAAAGG - Intergenic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
973832944 4:54780161-54780183 CTGAGTATGGAAAAGGACAATGG - Intergenic
973933392 4:55816883-55816905 TTGGATATGGAAATGGAGAAAGG - Intergenic
974201227 4:58643370-58643392 CTGAATTTGCCTATGAACAATGG + Intergenic
974629869 4:64474033-64474055 CTAAATAAGCAAATGTACATTGG + Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
975599258 4:76082297-76082319 CTGAATATGCCAAGGTAAAATGG - Exonic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977874373 4:102131213-102131235 CCGAATATGAAAATTCACAATGG - Intergenic
977902213 4:102435809-102435831 CCCAATATGAAAATGGGCAAAGG + Intergenic
978604299 4:110462678-110462700 TGGAATATGCAAGTGGACACAGG + Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979954457 4:126934996-126935018 CTGAATATGTACATCTACAATGG - Intergenic
979979176 4:127233810-127233832 CAGAATATGTAATTGGACATTGG - Intergenic
980208367 4:129752206-129752228 CTGAATGTGTAAAAGCACAAAGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981621417 4:146703936-146703958 CTTGGTATGCAAAAGGACAAAGG - Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983399316 4:167243729-167243751 CAGAATATCCAAATTGAGAAAGG - Intergenic
983758620 4:171375992-171376014 CTGATTAAGTAAATGGACACTGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
984435047 4:179699146-179699168 ATGAACATGCAAATTGACTAGGG - Intergenic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985025913 4:185738953-185738975 CTAACTATGCAAATAGAGAATGG - Intronic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
991025507 5:62025398-62025420 CTAAATATGGAAATGGAAACTGG - Intergenic
991171904 5:63637238-63637260 ATGAATATGGAAATGCACACTGG - Intergenic
991304035 5:65157796-65157818 CTGAATATGTAAAATGTCAAGGG - Intronic
992758740 5:79933214-79933236 CTTCAGAGGCAAATGGACAATGG + Intergenic
993172243 5:84433686-84433708 CTGATTAGGAAACTGGACAATGG + Intergenic
993518615 5:88869552-88869574 CTGCATATGCAGATAGATAATGG - Intronic
994431908 5:99677095-99677117 CTGCATATGCAATTTAACAAGGG + Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998923078 5:147092314-147092336 CCCCATATGCAAATGGAGAAAGG + Intergenic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000036220 5:157450271-157450293 TTTAATATGCTAATGTACAATGG + Intronic
1000898143 5:166881116-166881138 CTGAAAATGGAAAAGGACAAAGG - Intergenic
1001206878 5:169772019-169772041 CTGAAAATGCAAAATGACACTGG - Intronic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003869223 6:10388815-10388837 CTGAATCTGAAAGTGGACCAAGG + Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004091420 6:12506296-12506318 GTGAATATGCATAGCGACAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004977152 6:20980901-20980923 CTGAGTCTTCAAATGGGCAAAGG - Intronic
1005152770 6:22771884-22771906 CCGAAGATGAAAATGAACAAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1007962871 6:45976757-45976779 CTAAATATTCAAATGGGTAATGG + Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009313056 6:62181408-62181430 GATGATATGCAAATGGACAATGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1011114161 6:83872175-83872197 CTGAATGTGCAAAAAGATAATGG - Intronic
1011435530 6:87332769-87332791 CTGAAAAAGCAAATATACAAAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011954470 6:93008964-93008986 CTGAATATGCAAAGAAGCAATGG + Intergenic
1012207187 6:96476242-96476264 CTAAATATGGAAAGGAACAATGG - Intergenic
1012775091 6:103487261-103487283 CTGAATATCCAAATGGGGAGAGG + Intergenic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012884489 6:104830392-104830414 CAAAAAATGCAAATGAACAATGG + Intronic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013207067 6:107954964-107954986 CAAAATATGCATATGGACTAAGG + Intronic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015207947 6:130662085-130662107 CTGAATGTGCAACGGAACAAAGG + Intergenic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016941894 6:149489262-149489284 CAGAATAGGAAAATGGGCAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017349934 6:153428024-153428046 CTGGATATGTGAATGGACAATGG - Intergenic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018091472 6:160349359-160349381 CTCAAAATGCAAGGGGACAAAGG + Intronic
1020201526 7:6083808-6083830 CTGAATATGCAGATTGAGTAAGG - Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021683324 7:23156755-23156777 CTGAATATGAAAATGCACCCAGG - Intronic
1023000685 7:35804330-35804352 CTGATGATGCAAAAGGACACAGG - Intronic
1023824440 7:43999641-43999663 CTGAAGATGCTTTTGGACAATGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024646640 7:51376472-51376494 ATGAATGTGCAAATGGAAACTGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025312602 7:57967335-57967357 CAGAATCTGCAAGTGGACATTGG - Intergenic
1026087989 7:67278405-67278427 CTGAAGATGCTTTTGGACAATGG + Intergenic
1026478495 7:70758714-70758736 CTGAATTTGCCAAAGGATAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026726252 7:72871868-72871890 CTGAAGATGCTTTTGGACAATGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027048411 7:75006539-75006561 CAAAAGATGCAAATGGAAAAGGG - Intronic
1027117592 7:75493740-75493762 CTGAAGATGCTTTTGGACAATGG + Intergenic
1027327655 7:77060798-77060820 CTGAAGATGCTTTTGGACAATGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1029719908 7:102356309-102356331 CTGAAGATGCTTTTGGACAATGG - Intergenic
1029752705 7:102552948-102552970 CTGAAGATGCTTTTGGACAATGG + Exonic
1029770656 7:102652041-102652063 CTGAAGATGCTTTTGGACAATGG + Exonic
1030448051 7:109672326-109672348 CTGAACATGCTTCTGGACAAAGG + Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031789337 7:126080759-126080781 CTGAGTTTGCAACTGGATAATGG - Intergenic
1032130878 7:129226015-129226037 CTGAATATGTAAAAGGGTAATGG + Intronic
1032546087 7:132744168-132744190 CAGAATATGCAAATAGGAAAAGG + Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1034055220 7:148027220-148027242 CTGAATAGGCCTATGGAGAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1037346919 8:17910598-17910620 CAGAAAATGAAAACGGACAACGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041185398 8:55294922-55294944 CTTAATGTGCAAAGGGACACTGG - Intronic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041747809 8:61228420-61228442 CTGAATATGTAAGTTGAAAATGG + Intronic
1042293300 8:67192374-67192396 TTCAATTTGAAAATGGACAAAGG - Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043953917 8:86340175-86340197 CTCAGTAAGAAAATGGACAAAGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1045206577 8:100048182-100048204 CTAAATGTCCAAATGGAGAATGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1047104075 8:121713918-121713940 CTGCACAGGCAAATGGACAGAGG + Intergenic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047316805 8:123742011-123742033 GAGAATCTGTAAATGGACAAGGG + Intergenic
1047711645 8:127558715-127558737 CTGAACTTGAAAAAGGACAAAGG + Intergenic
1048266526 8:132992099-132992121 ATGAATAAGCAACTGAACAAAGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050609277 9:7334586-7334608 CTTAATGTGCAAATGGGCCACGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1052784382 9:32815033-32815055 ATTAATATGCACATGGACACAGG - Intergenic
1053182130 9:35981751-35981773 CTGAATTTGGAAATGGTCAAAGG - Intergenic
1053183456 9:35993961-35993983 TTGAATTTGTAAATGGCCAAGGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055498923 9:76884087-76884109 CAGAATAGGCAAATGGAGAGAGG - Intronic
1055641924 9:78325496-78325518 CTGCATCTGCAAAGGCACAAAGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057979309 9:99642871-99642893 CTCAATTTGAAAATGGCCAAAGG + Intergenic
1058880677 9:109283453-109283475 CAGGATATGCAACTGGAGAAAGG + Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061771355 9:132925740-132925762 CTGAAAATGTAAAAGAACAAGGG + Intronic
1203356972 Un_KI270442v1:161684-161706 TTGAATCTGCAAGTGGACATTGG - Intergenic
1203397245 Un_KI270519v1:34473-34495 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413429 Un_KI270589v1:20384-20406 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413481 Un_KI270589v1:21405-21427 TTGAATCTGCAAATTGACATTGG - Intergenic
1203413527 Un_KI270589v1:22257-22279 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413618 Un_KI270589v1:23898-23920 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413703 Un_KI270589v1:25429-25451 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413889 Un_KI270589v1:29742-29764 TTGAATCTGCAATTGGACATTGG - Intergenic
1203413995 Un_KI270589v1:31617-31639 TTGAATCTGCAATTGGACACTGG - Intergenic
1203414034 Un_KI270589v1:32297-32319 TTGAATCTGCAATTGGACATTGG - Intergenic
1203416419 Un_KI270591v1:2560-2582 TTGAATTTGCAATTGGACATTGG - Intergenic
1203416477 Un_KI270591v1:3582-3604 TTGAATCTGCAATTGGACATTGG - Intergenic
1203684245 Un_KI270757v1:27581-27603 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684284 Un_KI270757v1:28261-28283 TTGAATCTGCAATTGGACACTGG + Intergenic
1203684390 Un_KI270757v1:30136-30158 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684607 Un_KI270757v1:33783-33805 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684693 Un_KI270757v1:35314-35336 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684784 Un_KI270757v1:36955-36977 TTGAATCTGCAATTGGACATTGG + Intergenic
1203684831 Un_KI270757v1:37807-37829 TTGAATCTGCAAATTGACATTGG + Intergenic
1203684885 Un_KI270757v1:38828-38850 TTGAATCTGCAATTGGACATTGG + Intergenic
1186547471 X:10465431-10465453 CAGAATATGGCAAAGGACAAAGG + Intronic
1186939032 X:14484277-14484299 CTAATGATGCAAATGGAAAATGG + Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1187761215 X:22587887-22587909 ATGAATGTGCAAATGTATAAGGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191274665 X:58528201-58528223 CAGAATCTGCAAGTGGACATTGG + Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192356884 X:70412457-70412479 ATGAATTTGTAAATGGCCAAAGG + Intronic
1192383493 X:70640772-70640794 CTGAACATGGAAAGGAACAACGG + Intronic
1192808573 X:74530668-74530690 CTGAGTAAGCAAAAGGCCAAGGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193517328 X:82483270-82483292 CAGAATATGCTAAGTGACAAGGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194376972 X:93148693-93148715 ATTAATATGCAAATAGATAAAGG + Intergenic
1194725887 X:97396668-97396690 CTGAATGTGCAAAAGGATTATGG + Intronic
1194826461 X:98570405-98570427 ATGAATCAGCAAATGGACCAAGG - Intergenic
1195888159 X:109663269-109663291 CTGTGGATGAAAATGGACAAAGG - Exonic
1196262102 X:113595172-113595194 GAGGATATGCAAATGGACACAGG - Intergenic
1196716436 X:118815631-118815653 CTTAATTTTAAAATGGACAAAGG - Intergenic
1199995340 X:153021171-153021193 CTGAATCTGGAAATCGAGAAGGG + Intergenic
1200425389 Y:3014742-3014764 ATGAATAAGCAAATGAACAGAGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201510690 Y:14758247-14758269 CTGTATTTGCAAATGGATTAAGG + Intronic
1201541747 Y:15112315-15112337 CAGAACATGAAAGTGGACAAGGG + Intergenic
1201900535 Y:19043183-19043205 CTGTAGCTGCAAAAGGACAAGGG - Intergenic