ID: 1107779105

View in Genome Browser
Species Human (GRCh38)
Location 13:43879516-43879538
Sequence CGCTGCTGCCTCAGCAGTTC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107779105_1107779114 25 Left 1107779105 13:43879516-43879538 CCGGAACTGCTGAGGCAGCAGCG 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1107779114 13:43879564-43879586 GGATTCCCCAGCTCTCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 56
1107779105_1107779110 3 Left 1107779105 13:43879516-43879538 CCGGAACTGCTGAGGCAGCAGCG 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1107779110 13:43879542-43879564 TCGCGGCGCTTGGCTCATCCCGG 0: 1
1: 0
2: 0
3: 0
4: 34
1107779105_1107779111 4 Left 1107779105 13:43879516-43879538 CCGGAACTGCTGAGGCAGCAGCG 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1107779111 13:43879543-43879565 CGCGGCGCTTGGCTCATCCCGGG 0: 1
1: 0
2: 0
3: 7
4: 54
1107779105_1107779109 -7 Left 1107779105 13:43879516-43879538 CCGGAACTGCTGAGGCAGCAGCG 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1107779109 13:43879532-43879554 AGCAGCGGGCTCGCGGCGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 98
1107779105_1107779115 26 Left 1107779105 13:43879516-43879538 CCGGAACTGCTGAGGCAGCAGCG 0: 1
1: 0
2: 0
3: 20
4: 191
Right 1107779115 13:43879565-43879587 GATTCCCCAGCTCTCGCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107779105 Original CRISPR CGCTGCTGCCTCAGCAGTTC CGG (reversed) Exonic
900127364 1:1074468-1074490 CGCTGCAGCCTGGGCAGGTCTGG + Intergenic
900294022 1:1939612-1939634 CGCTCCTGCCCCAGGAGTTCGGG - Exonic
900922818 1:5684464-5684486 CGGTTCCGCCTCAGCAGGTCTGG - Intergenic
901079281 1:6574731-6574753 TGCTGCTGCTGCAGAAGTTCGGG + Exonic
901171657 1:7262825-7262847 AGCTGCTGCTGCAGCACTTCTGG + Intronic
901653505 1:10756207-10756229 CGTTGCTGCCTCTGGAGGTCAGG + Intronic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
904652208 1:32014108-32014130 CGCCGCTGCCTCACCGGTCCCGG + Exonic
904994426 1:34620089-34620111 TGCTCCTGACACAGCAGTTCTGG - Intergenic
906207759 1:43996212-43996234 CGCTGCCGCCTCAGCTGCTTTGG + Exonic
907940166 1:59079856-59079878 CAGTGCTGCCTCAGCAATCCAGG + Intergenic
915006645 1:152644507-152644529 GGCTGCTGCCTGAGCACTACAGG - Intergenic
916007670 1:160677090-160677112 CGCTGGTTCCTCAGCAGCTGAGG + Intergenic
918003441 1:180520031-180520053 TGTTGCTGCCTCAGGAATTCAGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
923850276 1:237786539-237786561 AGATCCTGCCTCAGCAGGTCTGG + Intronic
1063237890 10:4137513-4137535 CAATGTTGACTCAGCAGTTCTGG - Intergenic
1064136706 10:12757204-12757226 CACTGCAGCCTCAGCCGTCCCGG + Intronic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069285871 10:66714694-66714716 AGCTTCTGACTCAGTAGTTCTGG - Intronic
1069842407 10:71348039-71348061 CCCTGCTGCCTCAGCATGGCAGG - Intronic
1070034901 10:72712928-72712950 CCTTGCTGCCTCAGCATTTCTGG - Intronic
1073309641 10:102531177-102531199 CACTGCTGCCTCAGCCTTCCAGG - Intronic
1073329502 10:102661248-102661270 CGCTGCGGGCTCAGCACATCTGG - Intergenic
1075782370 10:125025864-125025886 CACTGCTGCCCCAGCAGATCTGG + Intronic
1077049768 11:561367-561389 CTCTGCGGCCTGAGCAGGTCGGG + Exonic
1077539019 11:3138033-3138055 TGCTGCGTCCTCAGCAGTGCAGG - Intronic
1080507312 11:32928052-32928074 AGCAGCAGCCTGAGCAGTTCGGG - Exonic
1081699993 11:45146851-45146873 CGCGGCTGCCGCAGCATTCCCGG + Intronic
1081710760 11:45213949-45213971 TGCTTCTGCCTCAGCTGTCCTGG + Intronic
1081970779 11:47197066-47197088 CACTGCTGCCTCAGCCTTCCAGG - Intergenic
1083684824 11:64369828-64369850 CCCTGCTGCGCCAGCAGCTCGGG - Exonic
1084680102 11:70662033-70662055 CGCTGCCGCCGCCGCCGTTCGGG - Intronic
1084752695 11:71214609-71214631 CACTGCTGTCTCAGCAAGTCTGG + Intronic
1086381680 11:86261495-86261517 CCCTGGTAGCTCAGCAGTTCTGG + Intronic
1089856173 11:121546883-121546905 AGATTCTGCCTCAGGAGTTCTGG + Intronic
1090268627 11:125370567-125370589 CGCGGCTGCCCCAGCACCTCAGG + Intronic
1090442243 11:126734074-126734096 AGCTTCTGCCTCAGTAGTTCTGG - Intronic
1091488945 12:916402-916424 AGCAGCTGCAGCAGCAGTTCCGG - Exonic
1091755719 12:3050181-3050203 AGCTGCTGCCTGAGCTGTGCAGG + Intergenic
1091792653 12:3280629-3280651 CACATCTGACTCAGCAGTTCAGG - Intronic
1092244071 12:6853151-6853173 AGCTGCTGCCTTCTCAGTTCAGG - Intronic
1094476965 12:30848041-30848063 GGCTGCTCCCTCAGCTCTTCAGG - Intergenic
1096121657 12:49092679-49092701 GGCTGCTGCCCCCGCAGGTCAGG - Intronic
1096710464 12:53452103-53452125 GGCTGCTGCCTCTGCTGGTCTGG - Intronic
1101013013 12:100470935-100470957 CACTGCAACCTCAGCATTTCGGG - Intergenic
1101433906 12:104648935-104648957 CCCTGCTTCCACTGCAGTTCAGG - Intronic
1102426435 12:112847869-112847891 CCCTCCTGCCACAGCAGCTCTGG - Intronic
1103064994 12:117890046-117890068 AGCTGCTGACTCAGTAGGTCTGG + Intronic
1103537837 12:121645532-121645554 AGCTGCAATCTCAGCAGTTCGGG - Intergenic
1104009107 12:124916587-124916609 CGCCCCTGCCTCTGCAGTTAGGG - Intronic
1104891584 12:132142757-132142779 CGCAGCTGCTTCTGCAGGTCAGG + Exonic
1105274530 13:18906841-18906863 CGCAGCTGCCTCCCCACTTCAGG - Intergenic
1105576891 13:21662060-21662082 TGCTGGTGGCTCAACAGTTCTGG + Intergenic
1106229123 13:27808168-27808190 CCCTGCTCCCTCATCAGTTCAGG - Intergenic
1106901568 13:34359285-34359307 TGGTGCTGCTTCTGCAGTTCTGG - Intergenic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1108570731 13:51747605-51747627 CACTGCAGCCTCAGCCTTTCAGG + Intronic
1108621301 13:52186734-52186756 CGGAGCTGCCTGAGCAGTTCTGG + Intergenic
1108665636 13:52627505-52627527 CGGAGCTGCCTGAGCAGTTCTGG - Intergenic
1112803853 13:103140591-103140613 TGCTCCTGCCTCAGCTTTTCTGG + Intergenic
1115203006 14:30874221-30874243 CGCCGCTGCCTCAGCAGCCCTGG + Intergenic
1117176735 14:53153217-53153239 CGCCGCTGCCGCCGCAGCTCGGG - Intronic
1118305314 14:64650433-64650455 CACTGCTGCCTAAGCAGGTCTGG + Intergenic
1120497657 14:85256637-85256659 CGCTGCAGCCTCAGCTTCTCAGG + Intergenic
1121251443 14:92502735-92502757 CGCTGCTCCCTCGTCTGTTCCGG - Intergenic
1122774518 14:104111375-104111397 CGCTGCTGGGTCAGCTGTTTGGG + Intronic
1123056432 14:105572741-105572763 AGCTGCAGCCTCAGCAGGACAGG - Intergenic
1123057501 14:105579066-105579088 AGCTGCAGCCTCAGCAGGACAGG + Intergenic
1123080865 14:105692869-105692891 AGCTGCAGCCTCAGCAGGACAGG - Intergenic
1123081776 14:105698999-105699021 AGCTGCAGCCTCAGCAGGACAGG + Intergenic
1124360863 15:29035775-29035797 AGCTTCTGGCTCAGCAGGTCAGG - Intronic
1125965609 15:43873389-43873411 CACTGCAGCCTCAGCAGGGCAGG - Exonic
1129983712 15:79897291-79897313 CGCTGCCGCCTCCGCGGTCCCGG - Intronic
1130691865 15:86088427-86088449 GGCTGCTGCCACAGCTTTTCTGG + Intergenic
1131112902 15:89776539-89776561 CGCGGCTGCCTCTGCGGCTCGGG - Exonic
1132329857 15:101004735-101004757 CCCTGCTCCTTCTGCAGTTCAGG + Intronic
1134097166 16:11425398-11425420 CACTGCTGACTCAGCTGTGCTGG - Exonic
1134611044 16:15607972-15607994 TGCAGCTGCCTCAGCACTGCTGG - Intronic
1134752328 16:16635896-16635918 CACTGCAGCCTCAACATTTCTGG + Intergenic
1134828055 16:17300358-17300380 CACTTCAGCCTCAGCAGTTGTGG + Intronic
1137798107 16:51238925-51238947 CCCTACTGCCTCAGTATTTCTGG - Intergenic
1140796097 16:78439752-78439774 CCTTGCTGCCTCAGCAACTCTGG - Intronic
1142296962 16:89230446-89230468 AGCAGCTGCCTCATCAGTGCCGG - Exonic
1142331281 16:89455370-89455392 CACTGCTGCCACAGCACTTAAGG - Intronic
1143188451 17:5024216-5024238 CGCTGCTTCCCCAGAAGTGCTGG + Exonic
1145991857 17:29084083-29084105 GGCTCCTTCCTCAGCAGCTCTGG - Intronic
1146595098 17:34161775-34161797 CTCTGCTGACTCAGCATCTCTGG + Intronic
1147053847 17:37818840-37818862 CACTGTTGACTCAGCAGGTCTGG + Intergenic
1148024229 17:44574684-44574706 CACTGCTGTCTCTCCAGTTCAGG - Intergenic
1148079962 17:44962272-44962294 CGCGGCTGAGTCAGCAGCTCTGG - Intronic
1151473674 17:74333065-74333087 AGCTGCTCCCGCAGCACTTCTGG - Intronic
1152373044 17:79902358-79902380 GGCTGCTGGCTGAGCACTTCGGG - Intergenic
1152821545 17:82440113-82440135 CGCTGCTCCCTCAGGAGACCTGG - Intronic
1152946378 17:83199658-83199680 CTCTGCTGCCGCTGCAGCTCCGG - Intergenic
1153649142 18:7224067-7224089 AGCTGCTACCTCAGTACTTCTGG + Intergenic
1156371423 18:36474751-36474773 CGCTCCTGCCCCAGGAGCTCAGG - Intronic
1158666462 18:59437275-59437297 CGCTGCTGTAGCAGCAGTTGCGG - Intronic
1160865795 19:1255432-1255454 CGCTGCTGTCTTGGCAGTTGGGG - Exonic
1161773120 19:6242043-6242065 CGCTTCTGCGCCAGCAGGTCAGG + Intronic
1162572842 19:11482634-11482656 CGCCGGTTCCTCACCAGTTCGGG - Intronic
1163882871 19:19942696-19942718 CGCTGCTACTCCAGCCGTTCAGG - Intergenic
1165962302 19:39545343-39545365 CGCTGCAGCCTCCGCTCTTCAGG + Intergenic
1166904116 19:46092554-46092576 CACTGCAGCCTCAGCCGCTCAGG - Intergenic
1167393950 19:49214890-49214912 GGCTGCTGCCTCAACATTTTAGG + Intergenic
1167926447 19:52825019-52825041 CCCTGCAGCCTCTGCATTTCAGG - Intronic
1168666046 19:58205699-58205721 TGCTGCCTCCTCAGCATTTCAGG + Intronic
925300357 2:2807403-2807425 CACTGCTGTCTCAGCAGTTGAGG - Intergenic
926246159 2:11123607-11123629 GGCTCCTGCCTCAGCAGGACAGG + Intergenic
934810542 2:97272992-97273014 TGCTACTGGCTCAACAGTTCTGG - Intergenic
934827150 2:97434947-97434969 TGCTACTGGCTCAACAGTTCTGG + Intergenic
938122251 2:128642153-128642175 CCCTGCTGCCTTCCCAGTTCTGG - Intergenic
938314954 2:130318884-130318906 CCCTGCTCCCTCACCAGTGCTGG + Intergenic
938387818 2:130880227-130880249 CCCTGCTGCCTCAGAAGTGGAGG + Intronic
939090056 2:137769873-137769895 CTCTGCAGCCTCAGCTGTTTAGG - Intergenic
941106649 2:161362139-161362161 CACTGCAGCCTCAGCCTTTCGGG + Intronic
942761192 2:179400075-179400097 AGCAGCTGCTGCAGCAGTTCTGG - Intergenic
944288960 2:197982725-197982747 AGCTACTCCCTCAGCAGATCAGG - Intronic
946572541 2:221040622-221040644 AGCTTCTGACTCAGCAGGTCTGG - Intergenic
948392453 2:237622440-237622462 GGCGGCTGCTGCAGCAGTTCTGG - Intergenic
948850509 2:240703200-240703222 AGCTGCTGCCTCAGCCGGGCAGG + Intergenic
948883617 2:240872508-240872530 CGCTGCTGCTTGGGCTGTTCTGG + Intronic
1170221489 20:13946892-13946914 CCCTGCTGCCTCAGCCCCTCTGG + Intronic
1170584037 20:17720945-17720967 AGGTGCTGACTCAGCAGGTCTGG - Intronic
1173097777 20:40053365-40053387 CAATCCTGGCTCAGCAGTTCAGG + Intergenic
1175270192 20:57728453-57728475 CTCAGCTGCCTCAGTAGGTCTGG + Intergenic
1178342705 21:31799924-31799946 AGCTGCTGCCACAGGAGTTGGGG + Intergenic
1178700348 21:34828029-34828051 CACTGGTGGCTCTGCAGTTCTGG - Intronic
1178846197 21:36176140-36176162 CTTTCCTGACTCAGCAGTTCTGG - Intronic
1179268273 21:39825207-39825229 AGCTGCTGCCTCAGGACTTTGGG + Intergenic
1180649974 22:17369566-17369588 CGCAGCCGCCTCAGTAGTTCGGG + Exonic
1181405046 22:22678426-22678448 AGATGCAGCCTCAGCAGTTCTGG + Intergenic
1181408202 22:22700071-22700093 AGATGCAGCCTCAGCAGTTCTGG + Intergenic
1181413520 22:22743383-22743405 AGATGCAGCCTCAGCAGTTCTGG + Intronic
1181874800 22:25931756-25931778 CACTGCAGCCTCAACATTTCAGG + Intronic
1182357277 22:29727874-29727896 GGATGCAGCCTCAGCAGCTCAGG - Intronic
1182967077 22:34532396-34532418 CACTGCAGCCTCAGCCTTTCGGG - Intergenic
1184687288 22:46102367-46102389 GGCTGCTGCCTCCTCAGCTCTGG + Intronic
950937342 3:16852731-16852753 AGCTTCTAACTCAGCAGTTCTGG + Intronic
952835017 3:37595178-37595200 CACTGCAGCCTCAGCAGCCCAGG + Intronic
952840376 3:37640895-37640917 CAGTGCTGCCTCATCATTTCCGG - Intronic
953015256 3:39069038-39069060 CGCTACAGCCTCAGCAGTCAAGG - Intronic
954622176 3:52002558-52002580 GGCTGCTGCCTGAGCAGGCCTGG + Intergenic
955555382 3:60131745-60131767 GGCTGCTGTCTCAGCAGTAGGGG - Intronic
956486951 3:69733114-69733136 CGCTCCTGCCTTAGTAGCTCTGG + Intergenic
960721212 3:120626183-120626205 TGCTGCTACCTCATTAGTTCAGG + Intergenic
963015800 3:140822774-140822796 AGATGCTGACTCAGCAGGTCTGG + Intergenic
963844726 3:150143686-150143708 AGCTGCTGCCTCAGAATTTGGGG + Intergenic
965560973 3:170062263-170062285 CGCTGCTGCCTCCGCCGCACGGG - Intronic
965816736 3:172644036-172644058 GGCTGCTTCCTCAGCAGATTTGG + Intronic
967991066 3:195131136-195131158 GGCTGCTTCCTCAGCAGCTTGGG - Intronic
970746905 4:19309596-19309618 CATTGCTGCCTCAGCATTTCCGG - Intergenic
971780571 4:31028964-31028986 CCCTGCTGAATCAGCTGTTCTGG - Intronic
974076118 4:57170124-57170146 AGCTGCAGCCTCAGCAGCTAAGG - Intergenic
976043680 4:80918835-80918857 AGCTGCTGCATCAGAAGTTCCGG + Intronic
977359026 4:95980871-95980893 CCCTGCTGCCTCAGCCCCTCTGG + Intergenic
985968239 5:3353808-3353830 CACTGCAGCCTCTGCAGCTCAGG - Intergenic
986559672 5:9048015-9048037 AGCTGATGCCTCAGCAGAGCTGG - Intronic
987379920 5:17275575-17275597 CGCGGCGGCCTCAGCAGCTTTGG - Exonic
987443862 5:17991958-17991980 AGCTGCTGGCCCAGCAGTCCTGG + Intergenic
987657441 5:20824157-20824179 CACTGTTGCCTCAGGAGTGCAGG + Intergenic
988080143 5:26403936-26403958 CACTGTTGCCTCAGCAGTGCAGG + Intergenic
988766103 5:34379789-34379811 CACTGTTGCCTCAGGAGTGCAGG - Intergenic
992134537 5:73730607-73730629 CGCTGCAGCCTCAGCCTTCCTGG + Intronic
992911174 5:81397448-81397470 CCCGGCTGCCTCTGCTGTTCAGG - Intergenic
995061448 5:107815215-107815237 CGCCTCTGCTTCAGCTGTTCAGG + Intergenic
995456354 5:112356808-112356830 GGCTGCAACCTCAGCATTTCTGG + Intronic
997501537 5:134378519-134378541 GGCTCATGCCTCAGCACTTCGGG - Intronic
999144093 5:149381300-149381322 CGCTGCTACTTCAGCATCTCTGG - Intronic
1001877757 5:175216131-175216153 CGCTGGTGCCTGAGCACTCCAGG + Intergenic
1002078235 5:176722467-176722489 CTCTGCAGCCTCACCAGCTCTGG + Intergenic
1002171626 5:177377969-177377991 GGCTGTTGCCTCAGCACTTCCGG - Intergenic
1004183939 6:13406002-13406024 GGATGCTGCCTCAGAAGTTGGGG - Intronic
1006824474 6:36924221-36924243 CAGTGCTGCCTCAGCAGTAGTGG - Intronic
1013510013 6:110835935-110835957 CCCTGCAGCCTCAGCCTTTCTGG - Intronic
1013998634 6:116339636-116339658 CACTGCTGCTTCACTAGTTCAGG - Intronic
1014811959 6:125896714-125896736 CACTGCAGCCTCAGCATCTCGGG - Intronic
1018198933 6:161377966-161377988 AGCTGCTGCCTCATCTGTTTGGG - Intronic
1019737588 7:2658370-2658392 AGCTGCTGCCACAGCTGTACAGG - Exonic
1020108012 7:5431223-5431245 CGCTGCAGCCTCAGCCTCTCGGG + Intergenic
1023694566 7:42831486-42831508 CTCTGCTGAAACAGCAGTTCAGG + Intergenic
1023694658 7:42832380-42832402 CTCTGCTGAAACAGCAGTTCAGG - Intergenic
1023758714 7:43444410-43444432 TGCTGCTTCCTCAGCTGGTCTGG - Exonic
1024598664 7:50961262-50961284 ACCTACTGCCTCAGAAGTTCTGG - Intergenic
1026412464 7:70139039-70139061 CACTGCAGCCTCAGCCTTTCTGG + Intronic
1026760938 7:73125201-73125223 CGCTGCTGCCTCACTGGTCCTGG + Intergenic
1027037280 7:74933997-74934019 CGCTGCTGCCTCACTGGTCCTGG + Intergenic
1027086282 7:75267455-75267477 CGCTGCTGCCTCACTGGTCCTGG - Intergenic
1029392585 7:100285482-100285504 CGCTGCTGCCTCACTGGTCCTGG - Intergenic
1034968454 7:155405208-155405230 CTATGCTGCCTCAGCAAGTCGGG - Intergenic
1036235704 8:7037633-7037655 CGCTGCAGCCTCAACATTCCAGG + Intergenic
1037024510 8:14017161-14017183 CCATGCTGCCTCAGCAGCACTGG - Intergenic
1037163625 8:15800495-15800517 CACTGCAGCCTCAGCAGCCCAGG - Intergenic
1037585282 8:20271674-20271696 CGCGGCTGCTTCACCAGTGCAGG + Intronic
1039818248 8:41113752-41113774 CACCCCTGCCCCAGCAGTTCAGG + Intergenic
1043448987 8:80348027-80348049 CTCTGCTGCCCCAGCAGTGCAGG - Intergenic
1044984564 8:97746145-97746167 CACTGCAGCCTCAGCCTTTCAGG - Intergenic
1047013235 8:120695130-120695152 CACTGCTGCCTCAGGAGATTGGG + Intronic
1048632275 8:136257095-136257117 AGCTGCTACCTGAGCAGTTTGGG - Intergenic
1048747583 8:137632070-137632092 ATCTGCAGCCTCAGCAGTTTTGG + Intergenic
1049642313 8:143721236-143721258 CGCTGCTGCCTCCACACTCCAGG - Exonic
1053054692 9:34987700-34987722 CGCTGCTGGCTCCTCAGATCTGG - Intergenic
1053434908 9:38068291-38068313 CGCTGCCGCCGCAGTAGTCCAGG + Exonic
1059137674 9:111822539-111822561 CTCTCCTGCCTCAGCATCTCAGG - Intergenic
1060955573 9:127636791-127636813 CACTGCAACCTCCGCAGTTCAGG + Intronic
1061514198 9:131079141-131079163 CCCTGCAGCCTCAGAAGTCCCGG + Exonic
1061645895 9:132001650-132001672 TGTTGCTGCCTCATCAGCTCTGG - Intronic
1187263555 X:17709747-17709769 TGCTGGTGCCTCAGGAGCTCTGG + Intronic
1196813048 X:119643767-119643789 CGCTGCTGCTTCAGAGGATCTGG - Intronic
1200986159 Y:9304867-9304889 GGCCCCTGCCTCAGCAGTCCTGG - Intergenic
1202124424 Y:21556035-21556057 GGCCCCTGCCTCAGCAGTCCTGG + Intergenic
1202154584 Y:21873345-21873367 GGCCCCTGCCTCAGCAGTCCTGG - Intergenic