ID: 1107791365

View in Genome Browser
Species Human (GRCh38)
Location 13:44005399-44005421
Sequence TCGGGTTACCTGTTGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107791365_1107791369 0 Left 1107791365 13:44005399-44005421 CCTTGCCTCAACAGGTAACCCGA No data
Right 1107791369 13:44005422-44005444 ACCATTAGCTTTGCTCTGATTGG No data
1107791365_1107791372 25 Left 1107791365 13:44005399-44005421 CCTTGCCTCAACAGGTAACCCGA No data
Right 1107791372 13:44005447-44005469 TCATTCACCCCAAACCAATCTGG No data
1107791365_1107791373 29 Left 1107791365 13:44005399-44005421 CCTTGCCTCAACAGGTAACCCGA No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107791365 Original CRISPR TCGGGTTACCTGTTGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr