ID: 1107791369

View in Genome Browser
Species Human (GRCh38)
Location 13:44005422-44005444
Sequence ACCATTAGCTTTGCTCTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107791365_1107791369 0 Left 1107791365 13:44005399-44005421 CCTTGCCTCAACAGGTAACCCGA No data
Right 1107791369 13:44005422-44005444 ACCATTAGCTTTGCTCTGATTGG No data
1107791363_1107791369 2 Left 1107791363 13:44005397-44005419 CCCCTTGCCTCAACAGGTAACCC No data
Right 1107791369 13:44005422-44005444 ACCATTAGCTTTGCTCTGATTGG No data
1107791364_1107791369 1 Left 1107791364 13:44005398-44005420 CCCTTGCCTCAACAGGTAACCCG No data
Right 1107791369 13:44005422-44005444 ACCATTAGCTTTGCTCTGATTGG No data
1107791366_1107791369 -5 Left 1107791366 13:44005404-44005426 CCTCAACAGGTAACCCGAACCAT No data
Right 1107791369 13:44005422-44005444 ACCATTAGCTTTGCTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107791369 Original CRISPR ACCATTAGCTTTGCTCTGAT TGG Intergenic
No off target data available for this crispr