ID: 1107791373

View in Genome Browser
Species Human (GRCh38)
Location 13:44005451-44005473
Sequence TCACCCCAAACCAATCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107791370_1107791373 5 Left 1107791370 13:44005423-44005445 CCATTAGCTTTGCTCTGATTGGC No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data
1107791366_1107791373 24 Left 1107791366 13:44005404-44005426 CCTCAACAGGTAACCCGAACCAT No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data
1107791364_1107791373 30 Left 1107791364 13:44005398-44005420 CCCTTGCCTCAACAGGTAACCCG No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data
1107791365_1107791373 29 Left 1107791365 13:44005399-44005421 CCTTGCCTCAACAGGTAACCCGA No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data
1107791367_1107791373 11 Left 1107791367 13:44005417-44005439 CCCGAACCATTAGCTTTGCTCTG No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data
1107791368_1107791373 10 Left 1107791368 13:44005418-44005440 CCGAACCATTAGCTTTGCTCTGA No data
Right 1107791373 13:44005451-44005473 TCACCCCAAACCAATCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107791373 Original CRISPR TCACCCCAAACCAATCTGGA TGG Intergenic
No off target data available for this crispr