ID: 1107795251

View in Genome Browser
Species Human (GRCh38)
Location 13:44045289-44045311
Sequence ATTTTATTATGGGTCATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107795251_1107795258 24 Left 1107795251 13:44045289-44045311 CCCTTAATGACCCATAATAAAAT No data
Right 1107795258 13:44045336-44045358 CAACCCAGTGCAGGTTGCCATGG No data
1107795251_1107795257 15 Left 1107795251 13:44045289-44045311 CCCTTAATGACCCATAATAAAAT No data
Right 1107795257 13:44045327-44045349 CTCTGCAGGCAACCCAGTGCAGG No data
1107795251_1107795255 1 Left 1107795251 13:44045289-44045311 CCCTTAATGACCCATAATAAAAT No data
Right 1107795255 13:44045313-44045335 CTCTTGCTACCAAGCTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107795251 Original CRISPR ATTTTATTATGGGTCATTAA GGG (reversed) Intergenic
No off target data available for this crispr