ID: 1107795806

View in Genome Browser
Species Human (GRCh38)
Location 13:44050373-44050395
Sequence TCAGTTCAACACACAGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107795806_1107795808 5 Left 1107795806 13:44050373-44050395 CCTTACACTGTGTGTTGAACTGA No data
Right 1107795808 13:44050401-44050423 TGAAAATAACTAAATCGTCCGGG No data
1107795806_1107795807 4 Left 1107795806 13:44050373-44050395 CCTTACACTGTGTGTTGAACTGA No data
Right 1107795807 13:44050400-44050422 TTGAAAATAACTAAATCGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107795806 Original CRISPR TCAGTTCAACACACAGTGTA AGG (reversed) Intergenic
No off target data available for this crispr