ID: 1107800664

View in Genome Browser
Species Human (GRCh38)
Location 13:44105204-44105226
Sequence AGAACCTTGCACTTGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107800664_1107800665 -10 Left 1107800664 13:44105204-44105226 CCAGAGAGCAAGTGCAAGGTTCT No data
Right 1107800665 13:44105217-44105239 GCAAGGTTCTTAAACAGTCCTGG No data
1107800664_1107800666 -6 Left 1107800664 13:44105204-44105226 CCAGAGAGCAAGTGCAAGGTTCT No data
Right 1107800666 13:44105221-44105243 GGTTCTTAAACAGTCCTGGTAGG No data
1107800664_1107800667 5 Left 1107800664 13:44105204-44105226 CCAGAGAGCAAGTGCAAGGTTCT No data
Right 1107800667 13:44105232-44105254 AGTCCTGGTAGGAGCTGAGAAGG No data
1107800664_1107800669 20 Left 1107800664 13:44105204-44105226 CCAGAGAGCAAGTGCAAGGTTCT No data
Right 1107800669 13:44105247-44105269 TGAGAAGGCCTCACCTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107800664 Original CRISPR AGAACCTTGCACTTGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr