ID: 1107806875

View in Genome Browser
Species Human (GRCh38)
Location 13:44161532-44161554
Sequence CATAATCAGGAGAAGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107806875_1107806879 8 Left 1107806875 13:44161532-44161554 CCAGCATTCTTCTCCTGATTATG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1107806879 13:44161563-44161585 CAAAGAGGCATCCCCTGAGCTGG 0: 1
1: 0
2: 0
3: 14
4: 141
1107806875_1107806877 -7 Left 1107806875 13:44161532-44161554 CCAGCATTCTTCTCCTGATTATG 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1107806877 13:44161548-44161570 GATTATGACATGCACCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107806875 Original CRISPR CATAATCAGGAGAAGAATGC TGG (reversed) Intergenic
901940415 1:12657576-12657598 CATAGTCAAGAAAAGAGTGCAGG + Intronic
902833018 1:19029782-19029804 CACAAACAGGAGCAGAATGTTGG - Intergenic
905409155 1:37756340-37756362 CAAAAATAGGGGAAGAATGCTGG + Intronic
907520509 1:55020499-55020521 AATTATCAGGCAAAGAATGCTGG + Intergenic
907887619 1:58607676-58607698 GATAATCAGGACAAGAACGGGGG - Intergenic
909154656 1:72058022-72058044 AATAATCAGGAAAAAAATGTAGG - Intronic
911032126 1:93500407-93500429 CATATCCTGGAGAAGAATGATGG + Intronic
912182559 1:107236684-107236706 CACTATCATGAGAAGAGTGCAGG - Intronic
912263714 1:108133439-108133461 CACTATCATGAGAAGAGTGCAGG + Intergenic
913312141 1:117511183-117511205 CATTATCAGGAGAACAATATGGG + Intronic
913512010 1:119570607-119570629 CACAATCAGGAAAAGAGTGTGGG + Intergenic
913516233 1:119607770-119607792 CACAATCAGGAAAAGAGTGTGGG + Intergenic
917045098 1:170850822-170850844 CACTATCAGGAGAACAGTGCAGG - Intergenic
917426549 1:174920389-174920411 CACTATCAGGAGAACAGTGCAGG + Intronic
919221920 1:194640442-194640464 CATTATCATGAGAAAAATACAGG - Intergenic
919239057 1:194888287-194888309 CATAATCAGGCCAAGCATACGGG - Intergenic
919518105 1:198552617-198552639 CATAAACAGGAGTAGAATGGTGG + Intergenic
923811777 1:237325978-237326000 CATAATAATGAGAAGGATGGTGG + Intronic
924455729 1:244217576-244217598 AATAAACAGGCTAAGAATGCTGG + Intergenic
1065251263 10:23816809-23816831 CATAGTCAGAAGGAGAATGGTGG + Intronic
1067904080 10:50272742-50272764 CATAATCAGGGTATGAATGTGGG - Intergenic
1067954204 10:50774488-50774510 CAGAACCAGGACAAGAATTCAGG - Intronic
1070654364 10:78261324-78261346 CATAATCAGGTGCATAATGGAGG - Intergenic
1072561515 10:96580144-96580166 AATAAGTAGGTGAAGAATGCCGG - Intronic
1074242386 10:111652042-111652064 GATAATCAGGAAAAGATTGTGGG - Intergenic
1075404027 10:122182545-122182567 CATTACCAAGAGATGAATGCAGG + Intronic
1076287425 10:129313812-129313834 TATAAACAGGAGAAGAGTTCAGG + Intergenic
1077656602 11:4025285-4025307 CATAATCAGGATTAGAATCCAGG - Intronic
1079664096 11:23082357-23082379 AATAATCAGGCCAGGAATGCTGG + Intergenic
1079809839 11:24983453-24983475 CATAGTCACTAGAAGAATGTTGG + Intronic
1079889984 11:26039779-26039801 GATAATCAGGAAATGAATCCAGG - Intergenic
1080711605 11:34753116-34753138 CCTTATGAGGAGAAGATTGCAGG + Intergenic
1083105494 11:60354321-60354343 CACTATCAGGAGAACAGTGCAGG - Intronic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1085326060 11:75607436-75607458 CGTGATCAGGAGAAGCATGTTGG - Intronic
1087702165 11:101447520-101447542 AATAATTAGGACAAAAATGCAGG + Intergenic
1087844963 11:102962531-102962553 CATCATCAGGAGAAGTCTGCTGG + Intergenic
1089340383 11:117753338-117753360 CAAAGGGAGGAGAAGAATGCGGG - Intronic
1090641737 11:128735102-128735124 AATAAACTGGAGAAGAAGGCAGG - Intronic
1091324452 11:134675970-134675992 CATAAGCAGGAGAAACATGAAGG - Intergenic
1092767107 12:11862619-11862641 CATACACAGGGGAAGAATGCAGG - Intronic
1093006464 12:14057011-14057033 CTGAATCAAGAGCAGAATGCTGG - Intergenic
1093424528 12:19012890-19012912 ATTCACCAGGAGAAGAATGCTGG + Intergenic
1093987570 12:25553680-25553702 CATAACTAGGAGAAGAATTTAGG - Intronic
1094363744 12:29658453-29658475 AATGATCAGGAGAAGAAGGAAGG - Intronic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1097888453 12:64753909-64753931 CATCCTCAGGAAAAGAATACTGG + Intronic
1099506593 12:83484889-83484911 CACTATCAGGAGAACACTGCAGG - Intergenic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1108036077 13:46292136-46292158 CATCATCATGAGAGGAATTCAGG - Intergenic
1108147699 13:47497244-47497266 CCTAAGCAGGAGAGGAATACAGG - Intergenic
1108758839 13:53537897-53537919 CATACTCAGAGGAAGAAAGCTGG - Intergenic
1109811966 13:67525100-67525122 CAGCATCATGAGAACAATGCAGG - Intergenic
1112999115 13:105611584-105611606 CAGAAACATGACAAGAATGCAGG - Intergenic
1114628217 14:24143121-24143143 GATAAGCAGGAGAAGAAAGAAGG + Intergenic
1114628528 14:24145242-24145264 GATAAGCAGGAGAAGAAAGAAGG - Exonic
1115464169 14:33696303-33696325 CAGAACCAGGAGTAGAATACGGG - Intronic
1116997023 14:51335130-51335152 CATAATCAGGAGAAGCTTCATGG + Intergenic
1118111050 14:62720219-62720241 AGTAAACAGGAGGAGAATGCTGG + Intronic
1118226070 14:63900494-63900516 CACAATCATGAGAACAGTGCAGG + Intronic
1120451767 14:84677423-84677445 CATAATAAGCAGAATGATGCTGG - Intergenic
1120465628 14:84853755-84853777 CATAACCAGGACAGGAATTCTGG + Intergenic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121343615 14:93119301-93119323 TGTAATCAGGGGAAGGATGCAGG - Intergenic
1124230951 15:27945723-27945745 CATAATCAGGGAAATAATGACGG + Intronic
1128234227 15:66056592-66056614 CAAAAGCCAGAGAAGAATGCAGG + Intronic
1128431505 15:67599438-67599460 GATAATTAGGAGTACAATGCAGG - Intronic
1129677675 15:77641242-77641264 CATCAGCTGGAGAAGAAGGCAGG - Intronic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1129976359 15:79825323-79825345 CAAATTCAGGACTAGAATGCAGG + Intergenic
1130008583 15:80127826-80127848 GGCAATCAGGAGAAAAATGCTGG - Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1130798891 15:87240245-87240267 CTTAATCAGCATAAGAATTCAGG - Intergenic
1132071611 15:98782071-98782093 CATAAACAGGAGACCAAGGCAGG - Intronic
1133784785 16:8965141-8965163 CATAAATGGGAGAAAAATGCAGG - Intergenic
1136358663 16:29763363-29763385 TATACCCAGGAGTAGAATGCTGG + Intergenic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1139388504 16:66589689-66589711 AATATACAGGAGAAGAATTCTGG - Intergenic
1139718632 16:68834681-68834703 CATACTCAGGAGATGAAAGAGGG - Exonic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1143563381 17:7708042-7708064 CATAATTAGGAGAGGAGTGAGGG - Exonic
1144087700 17:11825739-11825761 CACACTCAAGAGAGGAATGCAGG + Intronic
1144126400 17:12206828-12206850 CATATCCAGAAGAAGAATGTAGG - Intergenic
1147963929 17:44183198-44183220 CTGACTCAGGAGAAGACTGCTGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149156519 17:53636827-53636849 CATAATATGGAGAACACTGCAGG + Intergenic
1150588036 17:66535967-66535989 AATAATCAGGAGAATAAGGAGGG - Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1157182707 18:45511625-45511647 CATAACCAGGAAAAGCTTGCAGG + Intronic
1157507301 18:48237318-48237340 CATTGTGAGGAGAAGAATGGAGG + Intronic
1157976791 18:52337221-52337243 CAGAAACAGGAGAGAAATGCGGG - Intergenic
1158011203 18:52729940-52729962 AATCATCAGGAGTAGAATTCAGG + Intronic
1158516293 18:58132951-58132973 CATACTTAGGAGATGAATGCTGG + Intronic
1158571990 18:58604019-58604041 CAGCATGAGGAGGAGAATGCAGG + Intronic
1158855526 18:61540095-61540117 CAAAAGCAGGAGCAGAATGGAGG - Intronic
1159713763 18:71796423-71796445 CATGCTCAGGATCAGAATGCTGG + Intergenic
1161740488 19:6018264-6018286 CATAAAAAGGAGATGAAGGCCGG - Intronic
1164514607 19:28923068-28923090 GATGACCGGGAGAAGAATGCAGG + Intergenic
1165977931 19:39693658-39693680 CAGAATCAGGAGTGGAATCCAGG + Intergenic
1167906287 19:52663678-52663700 CATAATAAAGACTAGAATGCAGG + Intronic
924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG + Intergenic
926156214 2:10455397-10455419 CAAAAACAGGAAAAGAATCCAGG - Intergenic
926513649 2:13813443-13813465 AATAAGCTGGAGAAGAATGTGGG - Intergenic
926603864 2:14876855-14876877 CATAATCATCAGAAGCAGGCTGG - Intergenic
927122090 2:19975029-19975051 CATAATCTGGAGAAAAATTCTGG - Intronic
927415282 2:22872882-22872904 GATAAGTAGGAGAAGGATGCTGG - Intergenic
927612945 2:24560028-24560050 CATCATCAGGGGAAGTGTGCAGG - Intronic
928256672 2:29728919-29728941 CTTAATCAGGAGAAGGCAGCAGG - Intronic
928289873 2:30027732-30027754 CAAAATCATGAGAAGAATGGGGG + Intergenic
929627292 2:43422443-43422465 AATAATAAGGAGAATAATGTGGG + Intronic
929938358 2:46311391-46311413 CAGAACCAGGAAAAGACTGCAGG + Intronic
930401071 2:50888738-50888760 CAAAATCAGAACAATAATGCAGG + Intronic
930565003 2:53007712-53007734 CATAAATAGGACTAGAATGCAGG - Intergenic
931906916 2:66852310-66852332 CATAAGGGGGAGAAGAATGAGGG + Intergenic
932562593 2:72886752-72886774 CATGAGCAGGAGCAGAATCCTGG + Intergenic
933327917 2:80862682-80862704 AATAATCAGGACCAGAATGCTGG - Intergenic
934160440 2:89244531-89244553 CATAAGCAGCAGGAGAATGAGGG - Intergenic
934206837 2:89937907-89937929 CATAAGCAGCAGGAGAATGAGGG + Intergenic
936890817 2:117367507-117367529 CATTATCATGAGAACAGTGCAGG + Intergenic
937395822 2:121533816-121533838 CATAATAAGTAGCACAATGCTGG + Intronic
938130145 2:128708137-128708159 CATTTTCAGGGGAAGAATCCAGG - Intergenic
939375289 2:141357377-141357399 AATAATCAGGAAAAGAAAACAGG - Intronic
940075854 2:149741351-149741373 CATAAAATGGAGGAGAATGCTGG - Intergenic
941629305 2:167866304-167866326 AATACACAGGGGAAGAATGCTGG - Intergenic
942625302 2:177894095-177894117 CACATTCAGGAGAAGAAGCCAGG - Intronic
943000506 2:182322395-182322417 CATTATCATGAGAAGAGTACAGG - Intronic
943056148 2:182983101-182983123 CATATAAGGGAGAAGAATGCAGG + Intronic
943224450 2:185151680-185151702 CATTACCAGGAGAAGAACACGGG - Intergenic
943241625 2:185391662-185391684 AATAAACAGAAGAACAATGCAGG - Intergenic
943657058 2:190521016-190521038 CAAATGCAGGAGTAGAATGCTGG - Intronic
944071166 2:195671056-195671078 CAGAATCATGAGAGGAATTCTGG - Intronic
945385156 2:209189178-209189200 CAGAAACAGAAGTAGAATGCTGG - Intergenic
946382966 2:219361499-219361521 GAGAATCAGGAGCAGAATCCAGG + Intergenic
947330736 2:229026782-229026804 AAGAATCAAGAGTAGAATGCTGG + Intronic
947639613 2:231699637-231699659 CATAACCAGGAGAAAGATGCTGG + Intergenic
948075518 2:235162594-235162616 CAACATCAAGGGAAGAATGCTGG - Intergenic
948918176 2:241048811-241048833 CATAATCGGGAAATGAATGGTGG + Intronic
1169534561 20:6524628-6524650 AAAAATCAGGAGAACAATTCAGG - Intergenic
1170960411 20:21020401-21020423 CTTAATTAGGAGAAGTTTGCGGG - Intergenic
1175306823 20:57981923-57981945 AATAATCTGGAGAAGACTGGTGG + Intergenic
1177079602 21:16621972-16621994 CACCATCATGAGAACAATGCAGG + Intergenic
1177478025 21:21650013-21650035 CATTATCATGAGAACAGTGCAGG - Intergenic
1177988194 21:28004570-28004592 CACTATCAGGAGAACAGTGCAGG + Intergenic
1178150948 21:29793110-29793132 CATATTCAGGAGGAGGATGGAGG + Intronic
1179372540 21:40819690-40819712 CATATTCATGAGAAGAATGTTGG - Intronic
1182118623 22:27772963-27772985 GAGAATCAGGAGAAGAATTTGGG + Intronic
1182679781 22:32069894-32069916 CTGAATCAGGAGTAGAATCCAGG + Intronic
1184306831 22:43608844-43608866 GTTGATCAGGAGAAGAATCCAGG - Intronic
951173808 3:19575773-19575795 CATAATAACTAGAAGAATGATGG - Intergenic
951755186 3:26083285-26083307 AAAAATCAGGAAAATAATGCAGG - Intergenic
953826779 3:46260111-46260133 CACTATCAGGAGAACAGTGCAGG + Intronic
954977693 3:54712174-54712196 CATAAACAGGAAATGAATACAGG - Intronic
957380571 3:79423478-79423500 CATTATCAGGATCGGAATGCAGG - Intronic
958003161 3:87777213-87777235 CATATTCAGGAGAATATTGGAGG - Intergenic
959915993 3:111816912-111816934 CATTATCATGAGAACACTGCAGG - Intronic
960681034 3:120247704-120247726 CATACTTAGGAGAAGACTGGGGG - Intronic
960754279 3:120992812-120992834 AATACTCAGTAGTAGAATGCTGG + Intronic
963404184 3:144841560-144841582 CATAATGAGGAGAACAAAGAAGG + Intergenic
963985401 3:151587763-151587785 CATTATCATGAGAACAGTGCAGG - Intergenic
964021444 3:152017657-152017679 CAAAAACAGAAGAATAATGCTGG - Intergenic
965531086 3:169770021-169770043 TAAAATAAGGAGAAAAATGCTGG + Intergenic
965591588 3:170365212-170365234 CAGAATCAGGAGTTGAATACAGG + Intronic
969467980 4:7368859-7368881 CACTATCAAGAGAACAATGCAGG - Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
969867020 4:10082873-10082895 CAACAACAGGAGAACAATGCTGG + Intronic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
973735364 4:53866068-53866090 CATCAACAGGAGAAGAGTGATGG + Intronic
975457781 4:74613019-74613041 GTTAAGCAGGAGAAGAATGCTGG - Intergenic
975570269 4:75809718-75809740 CATAGTGAGAAGAAGAATGCTGG - Intronic
977415235 4:96724058-96724080 CACAATCAGGAGAACAGTGCAGG - Intergenic
978136192 4:105263633-105263655 GAGAATCAGGAGAAAAATTCAGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
978895444 4:113881421-113881443 CATATTCAAGACAAGAATCCTGG - Intergenic
980137446 4:128872232-128872254 CATTATCAGGAGAAGCATCTTGG + Exonic
980650808 4:135712287-135712309 CATTATAATGAGAAAAATGCCGG - Intergenic
981523507 4:145689811-145689833 CATATGCAGAAGAAGAAAGCTGG + Intronic
982379941 4:154739715-154739737 CAGAGTCAGGAGCAGAATGCAGG - Intronic
983686496 4:170415579-170415601 CATAATCAGGAGAAACAGGCAGG + Intergenic
983811600 4:172068914-172068936 CAAAGTCAGAACAAGAATGCAGG - Intronic
991205230 5:64042211-64042233 GATAAGCAGGCGATGAATGCTGG - Intergenic
993040167 5:82805258-82805280 CATAAGCAGGAGAATTATACTGG - Intergenic
994556528 5:101313832-101313854 CTTGATCAAGGGAAGAATGCAGG + Intergenic
994603851 5:101942558-101942580 GAAAATCATGAGAAGATTGCTGG - Intergenic
994941204 5:106326613-106326635 CACTATCAGGAGAACAGTGCAGG + Intergenic
995414249 5:111890976-111890998 CATTTTCAGGAGAAGAATTCAGG - Intronic
999482038 5:151957583-151957605 CAGAATCAAGACTAGAATGCAGG - Intergenic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000703880 5:164487554-164487576 CACTGTCAGGAGAAGCATGCGGG + Intergenic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1003729248 6:8802649-8802671 CACTATCAGGAGAAGAGTGCAGG + Intergenic
1004061071 6:12198637-12198659 CATAATAAGGATGAGAGTGCTGG + Intergenic
1007019136 6:38501774-38501796 CATAATAAAGAGAAGACTGCTGG - Intronic
1008402522 6:51080010-51080032 CATTAACAGGAAAATAATGCAGG + Intergenic
1011923311 6:92610263-92610285 CATAAGGAGGAGAAGAAAGACGG - Intergenic
1013320709 6:108985325-108985347 AATAATCATGAGAAGATTTCTGG - Intergenic
1014279423 6:119424384-119424406 AATAATCATGAAAAGAATGTTGG - Intergenic
1014728112 6:124997980-124998002 CACAATCAGAAAAGGAATGCCGG - Intronic
1015085370 6:129284138-129284160 CATAATCAGCAAAAGACTGAGGG - Intronic
1015916129 6:138219105-138219127 TTTAATCAGGAGAAGAGTTCAGG + Intronic
1016401664 6:143688092-143688114 CATAATGGGGACAAGAATTCAGG + Intronic
1016890840 6:149005361-149005383 CAGAAGCTGGAGAAGAATTCGGG + Intronic
1018482311 6:164204338-164204360 CACTATCATGAGAATAATGCAGG - Intergenic
1020921057 7:14264849-14264871 CAAAATCATGAGAAAAATGGGGG + Intronic
1021704174 7:23350719-23350741 AATTATCAGGAGCAGAAAGCGGG - Intronic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023373881 7:39537267-39537289 CAATATCAGGAAAAGTATGCTGG - Intergenic
1024253586 7:47523697-47523719 CATTATCAGGAGAAGGAACCAGG - Intronic
1024855984 7:53779729-53779751 CATCATCAGGTGTAGATTGCTGG - Intergenic
1026361344 7:69603433-69603455 AATAATCAAGATAAAAATGCAGG - Intronic
1027870030 7:83695135-83695157 CATAATCAAGTGCTGAATGCTGG - Intergenic
1029580615 7:101434703-101434725 CATGATGTGGACAAGAATGCAGG + Intronic
1029629581 7:101742212-101742234 CATAACCTGGAGAGGAATTCTGG + Intergenic
1030129967 7:106190998-106191020 AATTATCAGGAGATGAATTCTGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030904443 7:115164370-115164392 CATAAACAGAAGAATAAAGCTGG - Intergenic
1033725611 7:144113590-144113612 CTTGATCAGAAGAAGAAAGCAGG + Intergenic
1036929556 8:12941635-12941657 CATTCGCAGGAGAAGATTGCAGG - Intergenic
1037923260 8:22824301-22824323 TTTAAACAGGAGAAGAATGAGGG - Intronic
1039655543 8:39400820-39400842 CATAATCATGAACAGAATGTTGG - Intergenic
1040711128 8:50190207-50190229 AAGAATCAGAAGCAGAATGCTGG - Intronic
1041396141 8:57393628-57393650 CCGAATGAGGTGAAGAATGCTGG - Intergenic
1042264422 8:66893594-66893616 CATTATCATGAGAACAGTGCAGG + Intronic
1044297227 8:90543289-90543311 CATATGCAGGTGGAGAATGCTGG - Intergenic
1046546072 8:115651651-115651673 CATAAACAGGAGCACAAGGCGGG + Intronic
1048209739 8:132444860-132444882 CATAATCAGGTGAAGTGAGCAGG - Intronic
1048487021 8:134857718-134857740 CATCCTCTGGAGAAGACTGCAGG + Intergenic
1049535512 8:143178814-143178836 CATAACCCTGTGAAGAATGCAGG - Intergenic
1050549305 9:6735512-6735534 CACTATCAGGAGAACAGTGCAGG - Intronic
1050996547 9:12227001-12227023 GAAAATCAGGGGGAGAATGCAGG + Intergenic
1051007113 9:12358639-12358661 TATAATAAGCACAAGAATGCAGG - Intergenic
1051031926 9:12691264-12691286 CATAAAGAGTAGAAGAATGGAGG - Intronic
1056521248 9:87403616-87403638 GATAATCTGGAAAAGTATGCTGG + Intergenic
1059408055 9:114114163-114114185 CACTATCAGGAGAAGAGTGTGGG - Intergenic
1060070683 9:120544468-120544490 CATAACCTGGAGAAGAAGCCTGG + Intronic
1060682993 9:125582349-125582371 AATAATCAGGAGATGAATTTGGG - Intronic
1060762197 9:126263974-126263996 AATAATTAGGAGAAGAAAGGAGG - Intergenic
1060909980 9:127341818-127341840 TAGAAACAGCAGAAGAATGCAGG + Intronic
1061435664 9:130559844-130559866 CATAATGAGGATACGAAAGCTGG - Intergenic
1061605893 9:131710579-131710601 CATAATATGGGTAAGAATGCAGG + Intronic
1186734957 X:12452457-12452479 CATAATCAGCAGAAAACAGCTGG + Intronic
1188406623 X:29818482-29818504 CTTAATCAAAAGCAGAATGCTGG + Intronic
1189301724 X:39957130-39957152 CAGAATCAGGAGATCAATGGAGG + Intergenic
1191719752 X:64219602-64219624 AATAATCGAGAGAAGAATGATGG - Intergenic
1192770458 X:74183944-74183966 CACAATTAGGAGAAAAATTCTGG + Intergenic
1194288103 X:92036421-92036443 CACAATCATGAGAACAGTGCAGG - Intronic
1196170660 X:112584760-112584782 CATTATCAAGAGAACAGTGCAGG + Intergenic
1196743193 X:119043572-119043594 CAGAATCAGGACTAGAATCCAGG + Intergenic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1199190538 X:144964812-144964834 CACAATTAGCAGAAGAATGAGGG - Intergenic
1200101160 X:153689564-153689586 CAAGGTCAGGAGAAGGATGCTGG + Intronic
1200605625 Y:5260975-5260997 CACAATCATGAGAACAGTGCAGG - Intronic