ID: 1107808346

View in Genome Browser
Species Human (GRCh38)
Location 13:44175547-44175569
Sequence AGGGAGAGTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107808346_1107808357 26 Left 1107808346 13:44175547-44175569 CCCACAATCACTGCACTCTCCCT No data
Right 1107808357 13:44175596-44175618 GCATTTCCCTGGCTGCTGCTGGG No data
1107808346_1107808353 15 Left 1107808346 13:44175547-44175569 CCCACAATCACTGCACTCTCCCT No data
Right 1107808353 13:44175585-44175607 ATTCTCCCTCTGCATTTCCCTGG No data
1107808346_1107808358 27 Left 1107808346 13:44175547-44175569 CCCACAATCACTGCACTCTCCCT No data
Right 1107808358 13:44175597-44175619 CATTTCCCTGGCTGCTGCTGGGG No data
1107808346_1107808356 25 Left 1107808346 13:44175547-44175569 CCCACAATCACTGCACTCTCCCT No data
Right 1107808356 13:44175595-44175617 TGCATTTCCCTGGCTGCTGCTGG No data
1107808346_1107808359 28 Left 1107808346 13:44175547-44175569 CCCACAATCACTGCACTCTCCCT No data
Right 1107808359 13:44175598-44175620 ATTTCCCTGGCTGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107808346 Original CRISPR AGGGAGAGTGCAGTGATTGT GGG (reversed) Intergenic