ID: 1107810086

View in Genome Browser
Species Human (GRCh38)
Location 13:44192051-44192073
Sequence GGCTTGTGCTTGTGCAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107810078_1107810086 18 Left 1107810078 13:44192010-44192032 CCTATTACATAAAAACCCCAGGC No data
Right 1107810086 13:44192051-44192073 GGCTTGTGCTTGTGCAGTCCAGG No data
1107810082_1107810086 1 Left 1107810082 13:44192027-44192049 CCAGGCAACACAGCCAAGGATGT No data
Right 1107810086 13:44192051-44192073 GGCTTGTGCTTGTGCAGTCCAGG No data
1107810080_1107810086 3 Left 1107810080 13:44192025-44192047 CCCCAGGCAACACAGCCAAGGAT No data
Right 1107810086 13:44192051-44192073 GGCTTGTGCTTGTGCAGTCCAGG No data
1107810081_1107810086 2 Left 1107810081 13:44192026-44192048 CCCAGGCAACACAGCCAAGGATG No data
Right 1107810086 13:44192051-44192073 GGCTTGTGCTTGTGCAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107810086 Original CRISPR GGCTTGTGCTTGTGCAGTCC AGG Intergenic
No off target data available for this crispr