ID: 1107812256

View in Genome Browser
Species Human (GRCh38)
Location 13:44211844-44211866
Sequence AGGCCCTAAGGCCCCACGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812251_1107812256 14 Left 1107812251 13:44211807-44211829 CCACTGAGCAAATATCTAATTGC No data
Right 1107812256 13:44211844-44211866 AGGCCCTAAGGCCCCACGCCTGG No data
1107812254_1107812256 -8 Left 1107812254 13:44211829-44211851 CCTTTCAGGACACAGAGGCCCTA No data
Right 1107812256 13:44211844-44211866 AGGCCCTAAGGCCCCACGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812256 Original CRISPR AGGCCCTAAGGCCCCACGCC TGG Intergenic
No off target data available for this crispr