ID: 1107812257

View in Genome Browser
Species Human (GRCh38)
Location 13:44211847-44211869
Sequence GAGCCAGGCGTGGGGCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812257_1107812267 12 Left 1107812257 13:44211847-44211869 CCCTAAGGCCCCACGCCTGGCTC No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812257_1107812265 11 Left 1107812257 13:44211847-44211869 CCCTAAGGCCCCACGCCTGGCTC No data
Right 1107812265 13:44211881-44211903 ACCACTCTTGAGTGGACCCAAGG No data
1107812257_1107812263 3 Left 1107812257 13:44211847-44211869 CCCTAAGGCCCCACGCCTGGCTC No data
Right 1107812263 13:44211873-44211895 CACCTGTCACCACTCTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812257 Original CRISPR GAGCCAGGCGTGGGGCCTTA GGG (reversed) Intergenic
No off target data available for this crispr