ID: 1107812260

View in Genome Browser
Species Human (GRCh38)
Location 13:44211856-44211878
Sequence CAGGTGTCAGAGCCAGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812260_1107812263 -6 Left 1107812260 13:44211856-44211878 CCCACGCCTGGCTCTGACACCTG No data
Right 1107812263 13:44211873-44211895 CACCTGTCACCACTCTTGAGTGG No data
1107812260_1107812270 24 Left 1107812260 13:44211856-44211878 CCCACGCCTGGCTCTGACACCTG No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812260_1107812265 2 Left 1107812260 13:44211856-44211878 CCCACGCCTGGCTCTGACACCTG No data
Right 1107812265 13:44211881-44211903 ACCACTCTTGAGTGGACCCAAGG No data
1107812260_1107812267 3 Left 1107812260 13:44211856-44211878 CCCACGCCTGGCTCTGACACCTG No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812260 Original CRISPR CAGGTGTCAGAGCCAGGCGT GGG (reversed) Intergenic