ID: 1107812261

View in Genome Browser
Species Human (GRCh38)
Location 13:44211857-44211879
Sequence ACAGGTGTCAGAGCCAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812261_1107812267 2 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812261_1107812263 -7 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812263 13:44211873-44211895 CACCTGTCACCACTCTTGAGTGG No data
1107812261_1107812265 1 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812265 13:44211881-44211903 ACCACTCTTGAGTGGACCCAAGG No data
1107812261_1107812271 30 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data
1107812261_1107812270 23 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812261 Original CRISPR ACAGGTGTCAGAGCCAGGCG TGG (reversed) Intergenic
No off target data available for this crispr