ID: 1107812262

View in Genome Browser
Species Human (GRCh38)
Location 13:44211862-44211884
Sequence TGGTGACAGGTGTCAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812262_1107812272 26 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812272 13:44211911-44211933 TCTGCTCAATAAAGGCATTAGGG No data
1107812262_1107812271 25 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data
1107812262_1107812265 -4 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812265 13:44211881-44211903 ACCACTCTTGAGTGGACCCAAGG No data
1107812262_1107812270 18 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812262_1107812267 -3 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812262 Original CRISPR TGGTGACAGGTGTCAGAGCC AGG (reversed) Intergenic