ID: 1107812267

View in Genome Browser
Species Human (GRCh38)
Location 13:44211882-44211904
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812257_1107812267 12 Left 1107812257 13:44211847-44211869 CCCTAAGGCCCCACGCCTGGCTC No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812260_1107812267 3 Left 1107812260 13:44211856-44211878 CCCACGCCTGGCTCTGACACCTG No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812261_1107812267 2 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812254_1107812267 30 Left 1107812254 13:44211829-44211851 CCTTTCAGGACACAGAGGCCCTA No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812262_1107812267 -3 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812258_1107812267 11 Left 1107812258 13:44211848-44211870 CCTAAGGCCCCACGCCTGGCTCT No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
1107812259_1107812267 4 Left 1107812259 13:44211855-44211877 CCCCACGCCTGGCTCTGACACCT No data
Right 1107812267 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812267 Original CRISPR CCACTCTTGAGTGGACCCAA GGG Intergenic