ID: 1107812270

View in Genome Browser
Species Human (GRCh38)
Location 13:44211903-44211925
Sequence GGAGTTTGTCTGCTCAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812261_1107812270 23 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812264_1107812270 5 Left 1107812264 13:44211875-44211897 CCTGTCACCACTCTTGAGTGGAC No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812262_1107812270 18 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812266_1107812270 -2 Left 1107812266 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812260_1107812270 24 Left 1107812260 13:44211856-44211878 CCCACGCCTGGCTCTGACACCTG No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data
1107812259_1107812270 25 Left 1107812259 13:44211855-44211877 CCCCACGCCTGGCTCTGACACCT No data
Right 1107812270 13:44211903-44211925 GGAGTTTGTCTGCTCAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812270 Original CRISPR GGAGTTTGTCTGCTCAATAA AGG Intergenic
No off target data available for this crispr