ID: 1107812271

View in Genome Browser
Species Human (GRCh38)
Location 13:44211910-44211932
Sequence GTCTGCTCAATAAAGGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812261_1107812271 30 Left 1107812261 13:44211857-44211879 CCACGCCTGGCTCTGACACCTGT No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data
1107812266_1107812271 5 Left 1107812266 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data
1107812264_1107812271 12 Left 1107812264 13:44211875-44211897 CCTGTCACCACTCTTGAGTGGAC No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data
1107812262_1107812271 25 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data
1107812268_1107812271 -10 Left 1107812268 13:44211897-44211919 CCCAAGGGAGTTTGTCTGCTCAA No data
Right 1107812271 13:44211910-44211932 GTCTGCTCAATAAAGGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812271 Original CRISPR GTCTGCTCAATAAAGGCATT AGG Intergenic