ID: 1107812272

View in Genome Browser
Species Human (GRCh38)
Location 13:44211911-44211933
Sequence TCTGCTCAATAAAGGCATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107812264_1107812272 13 Left 1107812264 13:44211875-44211897 CCTGTCACCACTCTTGAGTGGAC No data
Right 1107812272 13:44211911-44211933 TCTGCTCAATAAAGGCATTAGGG No data
1107812268_1107812272 -9 Left 1107812268 13:44211897-44211919 CCCAAGGGAGTTTGTCTGCTCAA No data
Right 1107812272 13:44211911-44211933 TCTGCTCAATAAAGGCATTAGGG No data
1107812266_1107812272 6 Left 1107812266 13:44211882-44211904 CCACTCTTGAGTGGACCCAAGGG No data
Right 1107812272 13:44211911-44211933 TCTGCTCAATAAAGGCATTAGGG No data
1107812269_1107812272 -10 Left 1107812269 13:44211898-44211920 CCAAGGGAGTTTGTCTGCTCAAT No data
Right 1107812272 13:44211911-44211933 TCTGCTCAATAAAGGCATTAGGG No data
1107812262_1107812272 26 Left 1107812262 13:44211862-44211884 CCTGGCTCTGACACCTGTCACCA No data
Right 1107812272 13:44211911-44211933 TCTGCTCAATAAAGGCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107812272 Original CRISPR TCTGCTCAATAAAGGCATTA GGG Intergenic