ID: 1107814606

View in Genome Browser
Species Human (GRCh38)
Location 13:44233066-44233088
Sequence TCATACATGTTCCCACACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107814606_1107814615 12 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814615 13:44233101-44233123 CCTGGACCCTGGAGAGCTAGAGG No data
1107814606_1107814609 -6 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814609 13:44233083-44233105 GTATGAGGGCCCCAAGAGCCTGG No data
1107814606_1107814616 15 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG No data
1107814606_1107814620 20 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814620 13:44233109-44233131 CTGGAGAGCTAGAGGAGGATGGG No data
1107814606_1107814610 1 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814610 13:44233090-44233112 GGCCCCAAGAGCCTGGACCCTGG No data
1107814606_1107814619 19 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814619 13:44233108-44233130 CCTGGAGAGCTAGAGGAGGATGG No data
1107814606_1107814621 21 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814621 13:44233110-44233132 TGGAGAGCTAGAGGAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107814606 Original CRISPR TCATACATGTTCCCACACCC TGG (reversed) Intergenic