ID: 1107814616

View in Genome Browser
Species Human (GRCh38)
Location 13:44233104-44233126
Sequence GGACCCTGGAGAGCTAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107814605_1107814616 19 Left 1107814605 13:44233062-44233084 CCTTCCAGGGTGTGGGAACATGT No data
Right 1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG No data
1107814604_1107814616 20 Left 1107814604 13:44233061-44233083 CCCTTCCAGGGTGTGGGAACATG No data
Right 1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG No data
1107814606_1107814616 15 Left 1107814606 13:44233066-44233088 CCAGGGTGTGGGAACATGTATGA No data
Right 1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107814616 Original CRISPR GGACCCTGGAGAGCTAGAGG AGG Intergenic