ID: 1107817761

View in Genome Browser
Species Human (GRCh38)
Location 13:44259417-44259439
Sequence CAGGGAAATCAGTGGGCTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107817754_1107817761 1 Left 1107817754 13:44259393-44259415 CCATATATGTTTATCGACCTGAT No data
Right 1107817761 13:44259417-44259439 CAGGGAAATCAGTGGGCTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107817761 Original CRISPR CAGGGAAATCAGTGGGCTAC GGG Intergenic
No off target data available for this crispr