ID: 1107818013

View in Genome Browser
Species Human (GRCh38)
Location 13:44261658-44261680
Sequence ATGTCCATCAAGAAGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107818010_1107818013 -3 Left 1107818010 13:44261638-44261660 CCTTGGTGACTATTGAATAAATG No data
Right 1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG No data
1107818007_1107818013 14 Left 1107818007 13:44261621-44261643 CCCAGATTGCTGAATCTCCTTGG No data
Right 1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG No data
1107818009_1107818013 13 Left 1107818009 13:44261622-44261644 CCAGATTGCTGAATCTCCTTGGT No data
Right 1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107818013 Original CRISPR ATGTCCATCAAGAAGAGGAA GGG Intergenic
No off target data available for this crispr