ID: 1107819300

View in Genome Browser
Species Human (GRCh38)
Location 13:44271938-44271960
Sequence ATGTGGGCATAGCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107819300_1107819304 3 Left 1107819300 13:44271938-44271960 CCTCCTGAGTGCTATGCCCACAT No data
Right 1107819304 13:44271964-44271986 GCAGTAATCTAATTTCCATCTGG No data
1107819300_1107819305 15 Left 1107819300 13:44271938-44271960 CCTCCTGAGTGCTATGCCCACAT No data
Right 1107819305 13:44271976-44271998 TTTCCATCTGGTCAACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107819300 Original CRISPR ATGTGGGCATAGCACTCAGG AGG (reversed) Intergenic
No off target data available for this crispr