ID: 1107819690

View in Genome Browser
Species Human (GRCh38)
Location 13:44275208-44275230
Sequence TGCTTGCTTCTTTATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107819690_1107819692 -1 Left 1107819690 13:44275208-44275230 CCAGCCTCATAAAGAAGCAAGCA No data
Right 1107819692 13:44275230-44275252 AGCACAAATCCTAAATTCTGTGG No data
1107819690_1107819694 9 Left 1107819690 13:44275208-44275230 CCAGCCTCATAAAGAAGCAAGCA No data
Right 1107819694 13:44275240-44275262 CTAAATTCTGTGGTGTTTAATGG No data
1107819690_1107819695 12 Left 1107819690 13:44275208-44275230 CCAGCCTCATAAAGAAGCAAGCA No data
Right 1107819695 13:44275243-44275265 AATTCTGTGGTGTTTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107819690 Original CRISPR TGCTTGCTTCTTTATGAGGC TGG (reversed) Intergenic
No off target data available for this crispr