ID: 1107820284

View in Genome Browser
Species Human (GRCh38)
Location 13:44279782-44279804
Sequence CTCTGTAAGTCATAGATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107820278_1107820284 22 Left 1107820278 13:44279737-44279759 CCAGTATTTAAAACACAGAGATA No data
Right 1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107820284 Original CRISPR CTCTGTAAGTCATAGATGGA GGG Intergenic
No off target data available for this crispr