ID: 1107821029

View in Genome Browser
Species Human (GRCh38)
Location 13:44285843-44285865
Sequence CAGTTCATGCAGGACCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107821029_1107821033 5 Left 1107821029 13:44285843-44285865 CCCCTCAGGTCCTGCATGAACTG No data
Right 1107821033 13:44285871-44285893 TATGCTTCTTATTTCCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107821029 Original CRISPR CAGTTCATGCAGGACCTGAG GGG (reversed) Intergenic
No off target data available for this crispr