ID: 1107826548

View in Genome Browser
Species Human (GRCh38)
Location 13:44333522-44333544
Sequence CAGAGCCATGAACTTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107826548_1107826553 11 Left 1107826548 13:44333522-44333544 CCTGGTCCAAGTTCATGGCTCTG No data
Right 1107826553 13:44333556-44333578 ATATAAAGCTGACCACGGAAAGG No data
1107826548_1107826550 6 Left 1107826548 13:44333522-44333544 CCTGGTCCAAGTTCATGGCTCTG No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107826548 Original CRISPR CAGAGCCATGAACTTGGACC AGG (reversed) Intergenic
No off target data available for this crispr