ID: 1107826550

View in Genome Browser
Species Human (GRCh38)
Location 13:44333551-44333573
Sequence TGCCCATATAAAGCTGACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107826544_1107826550 23 Left 1107826544 13:44333505-44333527 CCCAACAGCTGAGGCACCCTGGT No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data
1107826547_1107826550 7 Left 1107826547 13:44333521-44333543 CCCTGGTCCAAGTTCATGGCTCT No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data
1107826545_1107826550 22 Left 1107826545 13:44333506-44333528 CCAACAGCTGAGGCACCCTGGTC No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data
1107826542_1107826550 24 Left 1107826542 13:44333504-44333526 CCCCAACAGCTGAGGCACCCTGG No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data
1107826549_1107826550 0 Left 1107826549 13:44333528-44333550 CCAAGTTCATGGCTCTGCAGAGC No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data
1107826548_1107826550 6 Left 1107826548 13:44333522-44333544 CCTGGTCCAAGTTCATGGCTCTG No data
Right 1107826550 13:44333551-44333573 TGCCCATATAAAGCTGACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107826550 Original CRISPR TGCCCATATAAAGCTGACCA CGG Intergenic
No off target data available for this crispr