ID: 1107831683

View in Genome Browser
Species Human (GRCh38)
Location 13:44379987-44380009
Sequence GTGCAGACATAGCCTTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107831683 Original CRISPR GTGCAGACATAGCCTTAAAA GGG Intronic
902755098 1:18543910-18543932 CTGAAGACCTGGCCTTAAAACGG - Intergenic
903252425 1:22065503-22065525 CTGCAGAAACAGCCCTAAAAAGG - Intronic
908654228 1:66370977-66370999 GTGCTTTCCTAGCCTTAAAAAGG - Intronic
914907231 1:151756603-151756625 GTGCAGTCATAGTCTGAGAAGGG + Intergenic
914970128 1:152301744-152301766 GTGCTGATATATCCTGAAAAAGG - Intergenic
916157087 1:161863111-161863133 ATTCAGACATAGCCTTAGAATGG + Intronic
920620347 1:207540185-207540207 ATCCAGTCATATCCTTAAAATGG + Intronic
920622129 1:207558742-207558764 ATCCAGTCATATCCTTAAAATGG + Intronic
920636375 1:207708382-207708404 ATCCAGTCATATCCTTAAAATGG + Intronic
1062905981 10:1180058-1180080 GGGCAGACATGGCCTGAAAGTGG + Exonic
1064533508 10:16333936-16333958 GTGCAGACATAGCCTATTATAGG - Intergenic
1066307481 10:34160607-34160629 ATGCAGAGATTGCCTTTAAAAGG + Intronic
1066605019 10:37156905-37156927 ATGCATATTTAGCCTTAAAATGG + Intronic
1068100633 10:52548093-52548115 GAGCAGCCACAACCTTAAAAAGG - Intergenic
1072279743 10:93854867-93854889 GTGAAGAAATAGCCTCAGAAAGG - Intergenic
1072282521 10:93880521-93880543 GTGAAGCCATAGCATGAAAAAGG + Intergenic
1083038818 11:59667409-59667431 ATGAAGACAAAGCTTTAAAACGG - Intronic
1088102528 11:106171009-106171031 GTCAAGAAATAGCCATAAAAAGG + Intergenic
1091447159 12:550650-550672 GTGCAGGGATAGCCTCAATAAGG - Intronic
1091600202 12:1913365-1913387 TTGCAGTTATAGCCTTAACAGGG + Intronic
1098786403 12:74762557-74762579 GTAAGGACATAGCCTTCAAAAGG + Intergenic
1098834300 12:75403096-75403118 GTGAAGACAAAGTCTTCAAAGGG - Intronic
1098937540 12:76497997-76498019 ATGCATCCATATCCTTAAAATGG - Intronic
1099948054 12:89267490-89267512 GTGCAAACATACTTTTAAAAAGG - Intergenic
1101348039 12:103904332-103904354 GGGATGACATAGCCTTAATATGG + Intergenic
1105246218 13:18652926-18652948 GTGAAGACATAGACTGAAATGGG - Intergenic
1106349817 13:28919714-28919736 CTACAAAAATAGCCTTAAAAAGG - Intronic
1106450132 13:29873725-29873747 GTTGTGACATAGCCTTATAATGG - Intergenic
1107831683 13:44379987-44380009 GTGCAGACATAGCCTTAAAAGGG + Intronic
1110378820 13:74825771-74825793 GTGCAGTCATTGCCTGTAAAAGG + Intergenic
1110410559 13:75200009-75200031 GTGCTGACAGAGAGTTAAAAAGG + Intergenic
1112035869 13:95496109-95496131 ATGCAGACACAGCCTGAGAAAGG - Intronic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1118191784 14:63587426-63587448 ATGCAGAGAAACCCTTAAAATGG + Intergenic
1120016796 14:79483002-79483024 GTGCACACACAGCTTGAAAAAGG - Intronic
1121253835 14:92517453-92517475 GTTCAGAAAGAGCCTTAACATGG + Intronic
1126320114 15:47412859-47412881 GGGCAGTCATACCCTTAACATGG + Intronic
1126727396 15:51646074-51646096 ATGCAAGCATATCCTTAAAAAGG - Intergenic
1127551106 15:60039274-60039296 GTGCAAATATACCTTTAAAATGG - Intronic
1133315464 16:4880949-4880971 ATACAGACATATCTTTAAAAAGG - Exonic
1133346239 16:5072369-5072391 GCTCAGACATAGCCTGACAAGGG - Intronic
1139518663 16:67466914-67466936 GTGAAGACAAAGCCTTCAGAGGG + Intronic
1140685006 16:77425154-77425176 CTGCAGTCATAGTCTAAAAAAGG + Intronic
1140865856 16:79061600-79061622 GTGCTCACACAGCCTTAAAATGG - Intronic
1149963877 17:61142212-61142234 GAGGAGACAAAGACTTAAAAAGG + Intronic
1150326786 17:64263750-64263772 CTGCAGACATTGATTTAAAAAGG + Intergenic
1154442700 18:14406740-14406762 GTGAAGACATAGACTGAAATGGG + Intergenic
1154508396 18:15066528-15066550 GTGCAAATATTGCCCTAAAATGG - Intergenic
1155029138 18:21969024-21969046 ATGGAGTCTTAGCCTTAAAAAGG + Intergenic
1155695439 18:28679924-28679946 GTTCAGACACAGCCTTTACATGG + Intergenic
1155900959 18:31389715-31389737 GGGCAGACATAGATTTGAAAGGG - Intronic
1159035502 18:63273768-63273790 GTATAGACAGAGCCTTAAGAGGG - Intronic
1161275983 19:3417556-3417578 GTACACACCCAGCCTTAAAATGG - Intronic
1164861624 19:31566274-31566296 ATGCAGACATGTCCTTAAGAGGG + Intergenic
925129538 2:1484662-1484684 GTGGAGTCATAGCCTTCATAGGG - Exonic
930371919 2:50512262-50512284 GAGCAGACCAAGCCTTAAAGAGG + Intronic
934674257 2:96238495-96238517 CAGCAGCCATAGCCTGAAAAGGG + Intergenic
937841912 2:126532947-126532969 GAGAAGACATCGCCTTGAAAGGG - Intergenic
939101520 2:137899798-137899820 GTGAAGACATAGACTGAAATGGG - Intergenic
939901023 2:147849570-147849592 GTCAAGATTTAGCCTTAAAAAGG - Intronic
942413003 2:175731239-175731261 TTGAAGATATAGCCTTAAAGAGG + Intergenic
943268145 2:185764134-185764156 GTGCACACATTACCCTAAAAAGG - Intronic
946658374 2:221973724-221973746 GTGCATACATAGGCCTTAAAAGG + Intergenic
947767510 2:232647141-232647163 GTGCAGTCATGGCCTTAATTAGG + Intronic
1169530128 20:6476337-6476359 TTGCAAACATGGCTTTAAAACGG - Intergenic
1170912306 20:20585084-20585106 GTGAAAACATATCCTTCAAATGG - Intronic
1174212456 20:48890662-48890684 GTGGAGACAGAGGCTTACAAAGG - Intergenic
1175287723 20:57848903-57848925 TTGGAGGCATAGCCTTAAAGAGG + Intergenic
1177988853 21:28013411-28013433 GTGCAAATATTGCCCTAAAATGG + Intergenic
1183164559 22:36137950-36137972 GTGCAGGCAGAGCCCTGAAAGGG + Intergenic
1183170861 22:36187100-36187122 GTGCAGGCAGAGCCCTGAAAGGG + Intergenic
1185417192 22:50716655-50716677 CTGAAGACACAGCCTTGAAAAGG - Intergenic
949444563 3:4120033-4120055 GTGCAGACATATCCTCACAGAGG + Intronic
950154571 3:10711980-10712002 GTGCTGACATAGCCTGGGAAAGG + Intergenic
952427437 3:33189978-33190000 GTCCAGTCATATCTTTAAAAGGG + Intronic
953781037 3:45870853-45870875 GTGCAGAGAAAGCCTTTAGAAGG - Intronic
953883229 3:46702064-46702086 GGGGAGACATAGCCTTAAGATGG + Intronic
955197465 3:56818335-56818357 GTGCAAACATAGCTTTGAGATGG - Intronic
959573054 3:107906254-107906276 GTGCAGACATTGCCTTGAAAAGG - Intergenic
964879591 3:161408837-161408859 CTGCAGACATAGCATTACACTGG + Intergenic
965899686 3:173623311-173623333 GTGCATACATAGTGTAAAAATGG + Intronic
967674866 3:192285005-192285027 GTACAGACATAGCCTTTATTCGG + Intronic
970468363 4:16350448-16350470 GTGCAGACATGGACTCAAAGAGG - Intergenic
971374644 4:26047204-26047226 CTGCAGAAAGAGCCTTACAAAGG + Intergenic
971785187 4:31092983-31093005 GTTCAGACAAAGCTTTAAAATGG - Intronic
973209149 4:47596160-47596182 GTGCAGAAAATGCCTGAAAAAGG - Intronic
974487147 4:62520938-62520960 GTACCAACATAGACTTAAAATGG - Intergenic
978178879 4:105769305-105769327 CTGCAGACCTAGCCTTATGATGG - Intronic
980330677 4:131407377-131407399 CTGCAGACTTATTCTTAAAATGG - Intergenic
980793620 4:137652432-137652454 GTGAACAAATAGCCTCAAAAAGG - Intergenic
984671041 4:182487883-182487905 GTGCAAACAGAGCCTTTAAATGG + Intronic
985003987 4:185514340-185514362 GTGAAAACAAAGCGTTAAAAAGG + Intronic
985969503 5:3363988-3364010 GTGCAGACAAAGCCTTCCAGGGG + Intergenic
987676048 5:21073635-21073657 TTGCACACATGGCCTTCAAAGGG - Intergenic
989240706 5:39200432-39200454 GTGAAGTCACAGCCATAAAATGG + Intronic
989726134 5:44588782-44588804 GTGGAAACATAGTCTAAAAATGG + Intergenic
995235716 5:109827709-109827731 GTTCAGACATCGCATTCAAAAGG + Intronic
995946791 5:117657565-117657587 CTGCAGCCAAATCCTTAAAATGG + Intergenic
998258495 5:140609204-140609226 GTGCAGACCTGGCCTGAAAGGGG + Intergenic
1003329142 6:5115329-5115351 GTGCCGCCAAAGCCTTCAAAGGG - Intronic
1004079329 6:12375808-12375830 GTCCAGACATATCCATAATAAGG - Intergenic
1006551718 6:34829402-34829424 GTTCAGGCATAACCTTAAAAAGG + Intronic
1008582842 6:52922068-52922090 CAGCAGACATAGAGTTAAAAAGG + Intergenic
1010278299 6:73994210-73994232 CTGCAGATACATCCTTAAAATGG - Intergenic
1014147066 6:118010524-118010546 GTATTGATATAGCCTTAAAAAGG - Intronic
1014725283 6:124964612-124964634 ATGCAAACAAAGACTTAAAACGG + Intronic
1021820361 7:24492121-24492143 ATGCAGACATAGCCTGAAAAAGG - Intergenic
1027546431 7:79532535-79532557 ATGCAGACATGGCCTTAAAGTGG - Intergenic
1027645519 7:80792863-80792885 GTGCAGACAGAGTCTACAAAGGG - Intronic
1028015275 7:85702422-85702444 AGGCAGACATAGCCTTTAAATGG - Intergenic
1028374100 7:90127561-90127583 GTGCACACATAGCTTTGCAAAGG - Intergenic
1030141228 7:106305984-106306006 GTGCAGGGCCAGCCTTAAAAAGG - Intergenic
1031217417 7:118912957-118912979 GTGAAGTTATACCCTTAAAAGGG - Intergenic
1031865538 7:127035282-127035304 GTATAGACACAGCCTTAACAAGG - Intronic
1032697626 7:134350993-134351015 GGGTAAACATGGCCTTAAAAGGG + Intergenic
1033827535 7:145209808-145209830 GTACAGACATGGCCTTCAAATGG + Intergenic
1034542903 7:151770313-151770335 GTGGAGACTTAACCTTTAAATGG - Intronic
1036766319 8:11551472-11551494 GTGGAGACAGAGCCTTTAAAGGG - Intronic
1037366706 8:18129948-18129970 TTGAAAAGATAGCCTTAAAAGGG + Intergenic
1037936135 8:22916183-22916205 GTGCAGAAATTGCCTTTAAGTGG - Intronic
1040898476 8:52392474-52392496 GGGAAGACATTGCCTTAATAGGG + Intronic
1043712115 8:83434308-83434330 GAGAAGAAATAGCCATAAAAAGG + Intergenic
1045739185 8:105334783-105334805 ATGCAGACATAGTTTTAAATTGG + Intronic
1046045367 8:108957514-108957536 GTCCAGAAATTGCCTTGAAAAGG - Intergenic
1047799696 8:128295977-128295999 TTGCTGACATAGACTGAAAAGGG + Intergenic
1052321726 9:27174701-27174723 GGGCAGACATAGCATTTAGAGGG - Intronic
1055035370 9:71812632-71812654 GTGCAGACACAGCTGCAAAAAGG + Intronic
1056235648 9:84591275-84591297 TTTCAGACAAAACCTTAAAAAGG + Intergenic
1058871250 9:109203350-109203372 GTGTAAACAGAGCCTTTAAAGGG + Intronic
1185822123 X:3215657-3215679 GTGAAGACAGAGCCTTTAAGGGG - Intergenic
1186410422 X:9341280-9341302 GTGCACACATAACTTAAAAATGG - Intergenic
1186724330 X:12340606-12340628 GTGCAGACCTTGCCTTACTAAGG - Intronic
1187932843 X:24309827-24309849 GTGCAGACAGGGCCTTTGAAAGG + Intergenic
1187939369 X:24366451-24366473 GTGCAGACAGGGCCTTTGAAAGG - Intergenic
1189708190 X:43780715-43780737 GCTCAGACATAGCCTTAAGTGGG - Intronic
1190331621 X:49239286-49239308 GTGGAAACTTAGCCTCAAAAAGG - Intronic
1195763429 X:108271558-108271580 GAGCAGACTCAGCCATAAAAGGG + Intronic
1195913832 X:109916143-109916165 GTGCACTCATAGCCTAGAAAAGG + Intergenic
1199095429 X:143733106-143733128 ATGAAGACATAGCCATAAAATGG + Intergenic
1200390602 X:155942160-155942182 TTGCAGCAGTAGCCTTAAAAAGG + Exonic