ID: 1107838188

View in Genome Browser
Species Human (GRCh38)
Location 13:44429082-44429104
Sequence CAGTGGAAGGAGAAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 1, 1: 1, 2: 7, 3: 87, 4: 695}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107838180_1107838188 6 Left 1107838180 13:44429053-44429075 CCAAGGTTGCCGGGTCTTCTCCA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG 0: 1
1: 1
2: 7
3: 87
4: 695
1107838179_1107838188 7 Left 1107838179 13:44429052-44429074 CCCAAGGTTGCCGGGTCTTCTCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG 0: 1
1: 1
2: 7
3: 87
4: 695
1107838181_1107838188 -3 Left 1107838181 13:44429062-44429084 CCGGGTCTTCTCCATCCCATCAG 0: 1
1: 0
2: 1
3: 32
4: 293
Right 1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG 0: 1
1: 1
2: 7
3: 87
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107838188 Original CRISPR CAGTGGAAGGAGAAGGAGCC TGG Intergenic
900001203 1:15795-15817 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
900465770 1:2824807-2824829 CAGAGGGAGGAGAGGCAGCCAGG - Intergenic
900599685 1:3497674-3497696 CCATGGAAGGCGAAGGAGCCGGG + Intronic
901226325 1:7614841-7614863 AAGTGGATGCAGATGGAGCCAGG - Intronic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
901829187 1:11881714-11881736 CAGGGGAATAAGGAGGAGCCAGG + Intergenic
902221933 1:14971907-14971929 CAGGGGAAGGAGGACGAGACTGG - Intronic
902456422 1:16536681-16536703 CAGTGGGACCAGCAGGAGCCTGG - Intergenic
902495741 1:16871230-16871252 CAGTGGGACCAGCAGGAGCCTGG + Intronic
902521328 1:17018677-17018699 CAGGGGAATGTGAAGGTGCCAGG - Intergenic
902554521 1:17239078-17239100 GAGAGGAAGGAGGAGAAGCCAGG + Intronic
902960119 1:19957384-19957406 TAGTGGAGGGTGAAGGAACCTGG + Intergenic
903269201 1:22177232-22177254 CAGGGGAGGGACAAGGAGCAAGG + Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903589617 1:24444756-24444778 CAGTGGAAGAAGTAAGAGCCTGG + Intronic
903653393 1:24934402-24934424 GAGGGGAGGGAGAAGGAGCAAGG + Intronic
904215382 1:28914732-28914754 CAGTGGCGGGCGCAGGAGCCCGG + Intronic
904494623 1:30879646-30879668 CAGGGGCAGGAGCCGGAGCCTGG - Intronic
905108350 1:35577156-35577178 AAGGGGAAGGGGCAGGAGCCGGG + Intronic
905277705 1:36829682-36829704 CACTGGGAGGAGGAGAAGCCAGG - Intronic
905298873 1:36972467-36972489 GAGTGGAAGGGGTAGGAGCAGGG + Intronic
905873855 1:41419709-41419731 CAGCAGAAGGAGCAGGAGCTGGG - Intergenic
905910362 1:41649311-41649333 CAGTGGGAGAAGGTGGAGCCTGG - Intronic
906592171 1:47035597-47035619 CAGCGGAGTGAGAAGGAGCATGG - Intronic
906656261 1:47550441-47550463 CTGAGGAGGGAGAAGGATCCTGG - Intergenic
907567450 1:55449081-55449103 GGGTGGGAGGAGAAAGAGCCAGG - Intergenic
907629848 1:56069526-56069548 CAGTGGAAAGAGCAGGAGCAAGG + Intergenic
907679695 1:56551561-56551583 AAGGGGAAGGAGAAGATGCCTGG + Intronic
907849792 1:58245249-58245271 AAGTGAAAGCAGAAGGTGCCTGG + Intronic
907901536 1:58746012-58746034 CAGCAGAGGGAGAAAGAGCCAGG - Intergenic
907999123 1:59663278-59663300 AAGTGGAAAGAGCAGAAGCCTGG - Intronic
908077420 1:60535692-60535714 ATGTGGAAGGAAAAGTAGCCTGG + Intergenic
908280604 1:62530883-62530905 CAGTGGGAGAAGGAGGAGCCAGG - Intronic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
909989998 1:82211839-82211861 AAGTGGAAGGAGATGGAGATAGG + Intergenic
910094468 1:83505247-83505269 CTCTGGAAGGAGGAGGAGGCAGG - Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912469081 1:109894312-109894334 GAGTGGGAAGAGAAGGGGCCTGG - Intergenic
913163114 1:116163219-116163241 CAGTGGAGGGAGATGGAGAGAGG + Intergenic
913185213 1:116364478-116364500 CAGTGGAAAGAGAAGGGGCTGGG + Intergenic
913388694 1:118286963-118286985 CTGAGGCAGGAGAATGAGCCCGG + Intergenic
914902845 1:151721157-151721179 CAGTGGAAAGGGAAGAAGCTTGG + Intronic
915252982 1:154603680-154603702 CACTGGAGGGTGATGGAGCCAGG + Intronic
915343281 1:155187663-155187685 CACTGGAAGGAGAGGGGCCCCGG + Intronic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916264136 1:162873260-162873282 CAATGTAGGGAGAAGGAGCCAGG - Intergenic
916492133 1:165311407-165311429 CAGTGGAAGTAGAATGGGCTTGG - Intronic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916889890 1:169105249-169105271 CAGTGGAAGCAGAAGCATCCCGG + Intergenic
917218703 1:172704631-172704653 CAATGGAAGGAGACAAAGCCAGG - Intergenic
917488669 1:175478691-175478713 CAGTGGCAGGAAACTGAGCCAGG - Intronic
917687972 1:177437387-177437409 CAGTGGAAGAAGTATGAGCTTGG - Intergenic
917793020 1:178511969-178511991 CAGCGGAAGGAGAGGGAGTTGGG - Intergenic
917966827 1:180184071-180184093 CAGAGGAAGGAGAAGAAGTGAGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918118444 1:181516944-181516966 CAGAGGAAGGAGGAAGAGCCAGG - Intronic
918212885 1:182367236-182367258 CAGTCAAAGGAGGAGAAGCCAGG + Intergenic
918434836 1:184500716-184500738 CAGTTAAAGGAGAAGGAGCTGGG + Intronic
920062538 1:203237635-203237657 CAGTGGAAGAAAGAGAAGCCAGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920345193 1:205301767-205301789 GGGTGGGAGGAGAAGGAGGCAGG + Intergenic
920371120 1:205479971-205479993 GAGGGGCAGGAGAAGAAGCCAGG + Intergenic
920415178 1:205794830-205794852 CAGGGGCATGGGAAGGAGCCAGG - Intronic
920435848 1:205946628-205946650 CAGCGGACAGAGAAGGAGCCGGG + Intergenic
920612870 1:207458718-207458740 CACTGGAAGGAGAAGGGACAGGG - Intronic
920703649 1:208236148-208236170 CTGTGGACGGGGAAGGAGCCTGG + Intronic
920843570 1:209575211-209575233 CACTGCACAGAGAAGGAGCCAGG + Intergenic
921252741 1:213312613-213312635 CTGTGGAAGGAAAGCGAGCCTGG + Intergenic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921687026 1:218101735-218101757 CAGGGGAAGGAAAAGGAGAAAGG + Intergenic
922436777 1:225614991-225615013 CCGTGGAGGGAGAGGGAGACCGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922597418 1:226824569-226824591 ATGTGGATGGAGAAGGATCCAGG - Intergenic
923110543 1:230886417-230886439 GAGTGGGAAGAGAAGGAACCTGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
924258247 1:242203618-242203640 CAGTGGCAAGAGAGGGAGCAAGG - Intronic
1062799713 10:369977-369999 CCGTGGAGTGAGCAGGAGCCGGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063346720 10:5318704-5318726 CAATGGTAGGAGAAGGAGGTTGG - Intergenic
1063675590 10:8138515-8138537 CAGGGGACAGAGAAGGGGCCTGG - Intergenic
1065497980 10:26349620-26349642 TAGAGGAAGGAGAGGAAGCCCGG + Intergenic
1065523022 10:26590178-26590200 CACTTGAAGGAGAAACAGCCCGG + Intergenic
1065528937 10:26649434-26649456 CACTTGAAGGAGAAACAGCCCGG + Intergenic
1065752728 10:28902527-28902549 CAATGGAAGGAGAAGGAGATAGG + Intergenic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1067192799 10:44085487-44085509 GAGGGGAAGGAGAAGCAGCTAGG - Intergenic
1067762403 10:49058121-49058143 CAATGGAAGGAGAAGCGGCAGGG - Intronic
1068303537 10:55176180-55176202 CTGAGGGAGGAGAAGAAGCCTGG - Intronic
1068779866 10:60907812-60907834 CAGTGGAAAGAGTGAGAGCCAGG + Intronic
1068806063 10:61195106-61195128 CAGGGGCAGGATAAGGACCCAGG - Intergenic
1068900885 10:62268506-62268528 CCGCGGAAGGTGAGGGAGCCGGG - Intronic
1068916466 10:62437739-62437761 CAAAGGAAGGAAAAGAAGCCAGG - Intronic
1068935516 10:62632217-62632239 CAGTGGAAAGAGCAGGGGCTGGG - Intronic
1069246888 10:66217959-66217981 TAGGGGAAGGAGCTGGAGCCAGG + Intronic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070309504 10:75262982-75263004 GACTGGAGGGACAAGGAGCCAGG - Intergenic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070586345 10:77769735-77769757 AAGTGGAAAGAGCAGGAGCCAGG - Intergenic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1071167024 10:82818420-82818442 CTGTGGAAGGAAAAGAAGACAGG + Intronic
1071198642 10:83191797-83191819 CAGTGGCAGGAGTAAGAGCCAGG + Intergenic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1072381233 10:94873073-94873095 CAGTGAAAGGAGAAGCAAACAGG + Intergenic
1073178210 10:101569288-101569310 CACAGGAAGGTGAAGGAGACAGG - Intergenic
1073250488 10:102117964-102117986 CTGGGGGAGGAGGAGGAGCCCGG + Intronic
1073325433 10:102642242-102642264 CAGGGAAAGGGGGAGGAGCCGGG + Intergenic
1074078738 10:110151579-110151601 AAGTGGAAGAGGAAGGAGACAGG - Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1074615369 10:115062054-115062076 CAGTTGGAGGAGGAAGAGCCTGG - Intergenic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1075051567 10:119186181-119186203 AACTGGAAAGGGAAGGAGCCAGG + Intergenic
1075427602 10:122353944-122353966 AAGAGGAAGGAGGAGGAGCCAGG - Intergenic
1075439682 10:122469753-122469775 CAGTGCAAGGAGGCAGAGCCAGG + Intronic
1075633238 10:124013922-124013944 CAGGGGAAGGAGGACTAGCCAGG - Intronic
1075646079 10:124097440-124097462 CAGTGGCAGGAGCAGGACCTGGG - Intergenic
1075747236 10:124736435-124736457 CTGGGTGAGGAGAAGGAGCCTGG - Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076704511 10:132293856-132293878 CCGGGGACGCAGAAGGAGCCAGG + Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1076886885 10:133267100-133267122 GAGTGGAAGGAGAAGGAGCCAGG + Intronic
1077121435 11:910731-910753 CCGTGCAAGGAGGAGGAGCAGGG + Intronic
1077160300 11:1109621-1109643 GAGGGAAAGGAGAATGAGCCCGG - Intergenic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078418101 11:11182421-11182443 CAGTGGGAAGAGAGCGAGCCGGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078846356 11:15122305-15122327 GATTGGAAGAAGAAAGAGCCTGG + Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079484625 11:20922475-20922497 AGGTGGAAGGAGATGGAGTCTGG + Intronic
1080222737 11:29924861-29924883 GAGTGGGACAAGAAGGAGCCTGG - Intergenic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1080872564 11:36250087-36250109 TAGGGGAAGGTGAAGGAGCTGGG - Intergenic
1081543898 11:44056111-44056133 CTAGGGAAGGAGGAGGAGCCAGG + Intronic
1081793883 11:45806449-45806471 CAGTCATAGGAGAAAGAGCCTGG + Intronic
1081909549 11:46692177-46692199 CAGTGGAAGGAAAAGCAGACTGG + Intronic
1082106553 11:48227744-48227766 CAGTGGGAGCAGAAAGATCCAGG - Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1082986729 11:59175481-59175503 CTGGGGAAGGAGAAGGGCCCAGG - Intronic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083252918 11:61479962-61479984 CAGTGGGTGGAGACGGAGCCTGG - Intronic
1083436514 11:62647040-62647062 GAGTGGACGGTGAAGGTGCCTGG + Exonic
1083887683 11:65580851-65580873 CAGTGGACAGAGAAAAAGCCTGG - Intronic
1083935656 11:65868551-65868573 CAGTGGCAGGAGAAACGGCCTGG + Exonic
1083935938 11:65870165-65870187 CACTGGCAGCGGAAGGAGCCAGG + Exonic
1084182658 11:67454508-67454530 GGGTGGAAGGAGCAGGAGCAGGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084890958 11:72237039-72237061 CAGTGGAAGGAGAACTAGACGGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1086066812 11:82754294-82754316 CAGTGGAAGAAGCATTAGCCTGG + Intergenic
1086458879 11:86985832-86985854 CATTTGCAGGGGAAGGAGCCTGG + Intergenic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087144246 11:94796499-94796521 GATTGAAAGGAGAAGGAGCCAGG + Intronic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1087692560 11:101338622-101338644 CAGTGCCTGAAGAAGGAGCCTGG + Intergenic
1087843276 11:102942271-102942293 AAGGAGAAGGAGAAGAAGCCAGG - Intergenic
1088267276 11:108000019-108000041 AAGTGGGAGGTTAAGGAGCCTGG + Intergenic
1088747603 11:112817452-112817474 CAGTGGTAGAAGAAGGATTCTGG - Intergenic
1089789047 11:120929371-120929393 CAATGGGATCAGAAGGAGCCAGG - Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090283381 11:125477774-125477796 CCCTGGAGGCAGAAGGAGCCAGG - Intronic
1090386036 11:126358002-126358024 CAGGGGATGGAGAGGGAGCTTGG + Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090660022 11:128875562-128875584 TAGAGGAAGGAGAAGCAGCATGG + Intergenic
1090908081 11:131094750-131094772 CTGTGGAAAGAGAAGGAGTTGGG + Intergenic
1090908331 11:131096632-131096654 CAGTGGCAGAGGCAGGAGCCTGG + Intergenic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092914074 12:13173733-13173755 ATGCGGAAGGGGAAGGAGCCAGG + Intergenic
1092982521 12:13810879-13810901 TATTGGAAGGAGAAGAAGACAGG - Intronic
1093373033 12:18387522-18387544 CAGTGGAGGGTGAAGGGGCGAGG - Intronic
1093558480 12:20508126-20508148 CAGTGCAATGAGAATGTGCCTGG - Intronic
1093662632 12:21774806-21774828 CAGTGGAAGGAGGAGGGACTGGG + Exonic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094094499 12:26688539-26688561 CAGAGGAAGAAGAAGGAGAAGGG + Intronic
1094404002 12:30094945-30094967 CAGGAGAAGAAGAAGGAGCGGGG - Intergenic
1095841646 12:46700543-46700565 GGGTGGATTGAGAAGGAGCCGGG - Intergenic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096238228 12:49944010-49944032 TGGTGGAATGAGAAGGGGCCAGG - Intergenic
1096543467 12:52321604-52321626 CAGTGGGAGGGGCAGGAGCAAGG - Intergenic
1096559318 12:52424435-52424457 GAGAGGAAGGAGGAGGACCCTGG + Exonic
1096632086 12:52934263-52934285 AAGGAGAAGGAGAAGAAGCCGGG + Intronic
1096863478 12:54547068-54547090 GAGAGGAATGAGAAGGAGCCTGG + Exonic
1096916000 12:55034405-55034427 CAGTGGGCTGAGCAGGAGCCAGG - Intergenic
1098001128 12:65944514-65944536 AAGTGTAAGGGGAAGGATCCAGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098282693 12:68877711-68877733 TAGTGGTAGGAAAAGGAGCTTGG + Intronic
1099379781 12:81939605-81939627 TGGAGGAAGGAGAAGGAGACAGG - Intergenic
1099451172 12:82808680-82808702 CAGTGGCAGGAGAAGAATACTGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101986502 12:109451495-109451517 CAAGGGAAGCAGAAGGGGCCCGG + Exonic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103091705 12:118102781-118102803 CAGGGAGAGGAGATGGAGCCAGG - Intronic
1103343615 12:120234881-120234903 CAGGGGGAGGAGTCGGAGCCAGG + Intronic
1103541964 12:121672486-121672508 CAGTGGAAGAGGGAGGAGCCGGG + Intronic
1103939789 12:124495487-124495509 CAGTGGATGGAGGAGGGTCCAGG - Intronic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1103971187 12:124673932-124673954 CAGTGGGAGCAGAAGGATCTGGG - Intergenic
1104557357 12:129813002-129813024 AAGTGGAAGGCGCAGGAGTCGGG - Intronic
1104645048 12:130491335-130491357 CAGTGGAGGGAGAGTGAGCTGGG - Intronic
1104926661 12:132317361-132317383 GAGTGGAAGGAGCAGGAGAGAGG - Intronic
1104966474 12:132510713-132510735 CAGTGGGGGGAGAGGGAGCATGG - Intronic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105435914 13:20378256-20378278 AGGTGGAAGGGGAAGGGGCCAGG - Intergenic
1106406560 13:29479888-29479910 CAGCGGCTGGAGAAGGAGCTGGG - Intronic
1106493824 13:30255540-30255562 AAATGGCAGGAGTAGGAGCCCGG - Exonic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1107661683 13:42645434-42645456 CCATGGAAGGAGAGGCAGCCAGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108692583 13:52872618-52872640 CAGTGAAAGAAAAAGGAGCATGG + Intergenic
1109819723 13:67637550-67637572 TAGTGGAAGGCGATGGGGCCTGG - Intergenic
1112039870 13:95536027-95536049 CAGTGGATGGAGAAGTAGATGGG + Intronic
1112088718 13:96058601-96058623 AAGTGGAAGGTGAAAGAGCAAGG + Intergenic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1113403629 13:110018474-110018496 CATTGGAAGGAGGAGGAGGAGGG - Intergenic
1113433122 13:110267260-110267282 CAGTGGAGGGAGGAGGGGCAGGG + Intronic
1113909507 13:113835557-113835579 CAGAGGCAGGAGTAGGAGCCGGG + Exonic
1114183242 14:20382389-20382411 CAGTGGGAGGAGAAGCAGCTTGG + Intronic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114814246 14:25937760-25937782 AAGTGGAAGGAGGGGGAACCAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115305258 14:31927372-31927394 CAGTGGAAGGAGAAGGAGTTGGG - Intergenic
1115963802 14:38864725-38864747 TGGTGGAAGGAGAGGGAGCATGG - Intergenic
1116050465 14:39796550-39796572 GAGTGGAAGGAGGAGAAGCAGGG + Intergenic
1116433063 14:44868504-44868526 CATAGGAAGGAGAAAGAGCCAGG + Intergenic
1116750303 14:48874676-48874698 CTCTGGAAGGAGAAAAAGCCTGG + Intergenic
1117066915 14:52020100-52020122 CAACGGCAGGAGAAGGAACCAGG + Exonic
1117232851 14:53739438-53739460 TTGAGGAAGGAGAAGGAGCAAGG + Intergenic
1117473562 14:56071015-56071037 ATGTGGAAGGAGAAGAAGGCAGG + Intergenic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118288698 14:64501791-64501813 GAGGGGAATGTGAAGGAGCCAGG - Intronic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118916059 14:70107303-70107325 CAGTAGATGTATAAGGAGCCTGG - Intronic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119775268 14:77244270-77244292 GAGTGGGAGGAGAAGAAGCAAGG + Intronic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120783012 14:88502849-88502871 ACGTGGAAGGAGAAGGAGAGAGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121115361 14:91339248-91339270 CAAAGGTAGGAGAAGCAGCCGGG + Intronic
1121291676 14:92780658-92780680 CAAGGGAAGGAGAAAGAGCTAGG + Intergenic
1121316538 14:92964340-92964362 CAGAGCCAGGACAAGGAGCCAGG + Intronic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121562864 14:94887489-94887511 CTGTGGAGGGAGAATGACCCAGG + Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122338239 14:101007632-101007654 GCCTGGAAGGAGAAGAAGCCAGG - Intergenic
1122482444 14:102055735-102055757 GTTTGGAAGGAGGAGGAGCCAGG - Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122925480 14:104897629-104897651 GAGTGGAAGGACAAGGGGCTCGG - Intergenic
1123711185 15:22988960-22988982 CAAGGGAAGGAGCAGGATCCGGG - Intronic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1124371281 15:29106247-29106269 GTGTGGAAGGAGCAGGAACCAGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125409901 15:39395254-39395276 CAATGGAAGGAGAAAGAGGAAGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125584510 15:40810538-40810560 CAGGGAAAGGAGAGGGATCCAGG - Intronic
1125609259 15:40959822-40959844 CAGTGGGAGGCCAAGGGGCCTGG - Intergenic
1126297311 15:47154911-47154933 CAGAGGAAGTAGAAAGAGCTTGG + Intergenic
1126959752 15:53978370-53978392 CGGCGGCAGGAGAGGGAGCCCGG + Intergenic
1128680857 15:69650341-69650363 CAGAGGAAGGAAATGCAGCCAGG - Intergenic
1128992730 15:72273902-72273924 GAGTGGTAGGGGAAGGAGTCAGG + Intronic
1129272656 15:74427694-74427716 CTGGGGGAGGAGGAGGAGCCAGG - Intronic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129719349 15:77869558-77869580 CAGTGGAGGGAGAAACATCCAGG + Intergenic
1130095415 15:80851910-80851932 GACTGGAAGGAGGAGGAGACTGG + Intronic
1130137938 15:81197288-81197310 CAGGGGCAGGAGCAGAAGCCAGG + Intronic
1130459575 15:84151290-84151312 CAGCGGAGGGAGAAGCATCCGGG - Intergenic
1131228781 15:90645897-90645919 TGGTGGCAGGAGAAGGGGCCTGG - Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132452306 15:101975144-101975166 CAGCAGAAGGAGCAGGAGCAAGG + Intergenic
1132454592 16:15480-15502 CAGCAGAAGGAGCAGGAGCAAGG - Exonic
1133863480 16:9619217-9619239 TGGTGGAAGGAGAAAGAGACAGG + Intergenic
1135028157 16:19014599-19014621 CAGGGGAAAGAGAAGGTGCTGGG - Intronic
1135140220 16:19914941-19914963 CAGGGGAAGGAGAAATACCCAGG - Intergenic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136554687 16:31001046-31001068 GGGTGGGAGGAGAAGGGGCCTGG - Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137725885 16:50656319-50656341 CAGTGGAAGGTGAAGGGGAGCGG - Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138749217 16:59398631-59398653 CTGAGGATTGAGAAGGAGCCAGG - Intergenic
1139237380 16:65354514-65354536 CAGAGGAAGGATAAGGAGCTGGG - Intergenic
1139458876 16:67106607-67106629 CAATAGAAGCAGAAGGTGCCTGG - Intergenic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1140213405 16:72988385-72988407 CAGTGGCTGGAGAAGGATCTTGG - Intronic
1140781818 16:78303849-78303871 CAGTGGTGGGAGAAAGAGCACGG - Intronic
1141031061 16:80589001-80589023 AAGAGGAAGGAGAAGAAGACTGG + Intergenic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141733118 16:85835384-85835406 CAGTGGCAGGAGGCAGAGCCAGG + Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142675973 17:1513598-1513620 CTGTGGCAGGGGAAGTAGCCTGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1144430350 17:15185542-15185564 GGGTGGAAGGAGAATGAGACTGG + Intergenic
1144645859 17:16972922-16972944 CTGTGGCAGGAGAATGAACCTGG + Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146704716 17:34992612-34992634 CAGGAGGTGGAGAAGGAGCCGGG + Exonic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147189568 17:38730674-38730696 CAGTGGAAAGGGAAGGACACGGG - Intronic
1147426669 17:40348990-40349012 CAGGGAAAGGAGGAGAAGCCGGG - Intronic
1147725555 17:42564331-42564353 GAGTCGGAGGAGGAGGAGCCTGG + Intronic
1147976894 17:44253048-44253070 AAGGGGAAGGGGAAGGGGCCGGG + Intronic
1148127193 17:45242942-45242964 CAGGGGAAGCACAGGGAGCCTGG - Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149018709 17:51938342-51938364 CAGTCGAGGGTGAAGGATCCAGG + Intronic
1149816638 17:59731684-59731706 CAGTGATGGCAGAAGGAGCCTGG + Intronic
1150009984 17:61494432-61494454 GAGTGGAAAGAGAAGAGGCCTGG + Intergenic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150963997 17:69947036-69947058 CAGTGGAATGGGAAGAAGCTGGG + Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151484265 17:74388740-74388762 TACTGGGAGGAGAGGGAGCCAGG + Intergenic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1151682396 17:75628987-75629009 CAGGGGAGGAAGATGGAGCCGGG - Exonic
1151759643 17:76093310-76093332 CACTGGAGGGAGAAGGCCCCAGG + Intronic
1151850575 17:76687328-76687350 CAGTGGAAAGAGAAGGTTTCAGG - Intronic
1152231232 17:79115104-79115126 TAGTGGAAAGTGAAGGAGACGGG - Intronic
1152231419 17:79115749-79115771 CTGTGGAAGGAGAGAGAGCAAGG + Intronic
1152287272 17:79420486-79420508 CTGTGGAGGGAGAAGGTCCCAGG - Intronic
1152456897 17:80421927-80421949 CAGCTGCGGGAGAAGGAGCCGGG + Exonic
1152830930 17:82496725-82496747 CTGTGGAAGGCGCAGGGGCCAGG + Intergenic
1152942063 17:83178009-83178031 TAGTGGAATGAGCAGGAGCCGGG - Intergenic
1153328628 18:3848836-3848858 GAGTGGAAGGAGAAGGACAGTGG - Intronic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1153591079 18:6674684-6674706 TAGTGGAAGGAGATAAAGCCTGG - Intergenic
1153893844 18:9541601-9541623 GAGGGGAGGGAGAGGGAGCCAGG - Intergenic
1156196609 18:34781120-34781142 CAGGGGCAGGAGAAAGAGGCAGG + Intronic
1156219397 18:35036502-35036524 CAGTGGTAGGAGATGGGGCAAGG - Intronic
1156278631 18:35610281-35610303 CAGGGCAATGAGAAGCAGCCTGG - Intronic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156785685 18:40911499-40911521 CAATGGAAGGGGAAGAGGCCTGG - Intergenic
1156920077 18:42511433-42511455 CAGTGAAAGGATATTGAGCCGGG - Intergenic
1157244426 18:46040894-46040916 CAGGAGAGGGAGAAGGAGCTGGG + Intronic
1157528114 18:48400540-48400562 CATTGGAAGGGGAAGCAGCAGGG - Intronic
1157562667 18:48659749-48659771 GAGAGGAAGGAGAAGCAGCCTGG + Intronic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1160863303 19:1246661-1246683 CACTGGAAGCAGAATGAGCCTGG + Intergenic
1160891395 19:1380570-1380592 CAGTGAGAGGGGAAGGACCCAGG - Intergenic
1160949417 19:1658365-1658387 CAGGTGCAGGTGAAGGAGCCTGG - Intergenic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161037531 19:2093738-2093760 CTGTGGAAAGAGAGGGAGCTGGG + Intronic
1161379802 19:3958951-3958973 GAGTGGGAGGAGCTGGAGCCAGG - Exonic
1161652821 19:5495898-5495920 TTGTGGAAGAAGATGGAGCCAGG + Intergenic
1161905847 19:7155944-7155966 AAGGAGGAGGAGAAGGAGCCAGG + Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162315200 19:9934586-9934608 CAGTGGAAAAAAAATGAGCCAGG - Intronic
1162409882 19:10499347-10499369 CAGTGTCAGGAGAAGGACCAGGG - Intronic
1162493337 19:11008292-11008314 TAGTGGAAAGGGAGGGAGCCGGG - Intronic
1163116524 19:15192085-15192107 CACTGGCAGCGGAAGGAGCCAGG + Exonic
1163955862 19:20639113-20639135 AAGTGTGAGGTGAAGGAGCCAGG + Intronic
1163960090 19:20681699-20681721 AAGTGTGAGGTGAAGGAGCCAGG - Intronic
1164075202 19:21810324-21810346 AAGTGTGAGGTGAAGGAGCCAGG + Intronic
1164103455 19:22080425-22080447 AAGTGTAAGGTGAAGGAGCCAGG - Intronic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164924868 19:32122722-32122744 CACTGGAAGCAGAGTGAGCCTGG - Intergenic
1167019536 19:46863085-46863107 AAATGGGAAGAGAAGGAGCCTGG - Intergenic
1167713249 19:51125092-51125114 GAGGGGTAGGAGAAGGAGCAGGG - Exonic
1167738141 19:51310174-51310196 CAGTGAAAGAACAGGGAGCCAGG + Intergenic
1167776957 19:51564720-51564742 CTGGGGTAGGAGAAGGAGCAGGG + Intergenic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1167888593 19:52522152-52522174 AAGAGGAAAGAAAAGGAGCCAGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925596875 2:5563951-5563973 TATTGGCAGGAGAAGGTGCCAGG + Intergenic
925684705 2:6458952-6458974 CTGGGGAAGGACAAAGAGCCTGG - Intergenic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
926188067 2:10707180-10707202 CAGTGGCAGGGGAAGAAACCAGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929589302 2:43134692-43134714 CAGGGGCAGGGGAAGGAGCGGGG - Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
929934429 2:46284328-46284350 CCCTGGATTGAGAAGGAGCCAGG + Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
930752866 2:54949225-54949247 AAGTGGAGGGAAACGGAGCCAGG - Intronic
932221132 2:69999877-69999899 GGGAGGAAGGAGGAGGAGCCCGG - Intergenic
932425884 2:71634901-71634923 TAGTGGAGAGAGAAAGAGCCAGG - Intronic
932465181 2:71917120-71917142 CATGAGAAGAAGAAGGAGCCTGG - Intergenic
932583074 2:73005133-73005155 AAGTGGAAGGAGAGGGAAACAGG + Intronic
933291286 2:80441160-80441182 GGGTGGAAGGAGAAAGAGCCAGG + Intronic
933685705 2:85139798-85139820 GCCTGGAAGGAGAAGGGGCCAGG + Intronic
933727201 2:85433702-85433724 CAAGGGAAGCAGATGGAGCCAGG - Intronic
933730481 2:85452457-85452479 CAGTGGCAGGAAATGGAGCCAGG - Intergenic
933769611 2:85734709-85734731 TAATGGAAGGAGAAGGTTCCTGG - Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
935079486 2:99778199-99778221 CAGAGGAAGGAGGAGGAGAAGGG - Intronic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935269233 2:101419420-101419442 CTGTGGAAGGAAAAGGAGACTGG + Intronic
935681884 2:105645305-105645327 GAGTGGGAGGAGAGGGAGCGGGG - Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936816277 2:116464679-116464701 AAGTGGGAGGAGGAGGTGCCAGG + Intergenic
938207757 2:129438537-129438559 CTGGGGAGGGAGAGGGAGCCTGG - Intergenic
938597307 2:132801100-132801122 CAGTGGAAGGATAAAGAGCATGG - Intronic
938719818 2:134056669-134056691 CAGAGGAAGGAGAAAAAGACAGG + Intergenic
939281498 2:140071494-140071516 CAGTGGGAGGAAAAGCAGCAGGG - Intergenic
942103332 2:172607762-172607784 CAGGGGAAGGAAAAGGAGCAGGG + Intronic
944565597 2:200987307-200987329 CAGTTGCTGGAGAAGGATCCTGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945522614 2:210847226-210847248 CAGTGGGATGAGGAGGAGGCTGG - Intergenic
946119322 2:217495662-217495684 ACGTGGTAGGAGAAGAAGCCAGG + Intronic
946416866 2:219544117-219544139 AAGGGGAAGGCGCAGGAGCCGGG - Intronic
946669672 2:222089362-222089384 CAGAGGATGGAGAGAGAGCCCGG - Intergenic
947926124 2:233924135-233924157 CAGTGTCAGGAGAAGGTCCCTGG - Intronic
948229268 2:236337618-236337640 CAGTGGAGCGAGGAGGAGCCTGG - Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948748194 2:240110734-240110756 GAGGGGAAGGAGAAGGAGAGTGG - Intergenic
948807099 2:240457724-240457746 GAGAGGCAGGAGAGGGAGCCAGG - Intronic
948998316 2:241596049-241596071 CAGCGGAAGGACATGGAGCACGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168754639 20:307964-307986 GGTTGGAAGGAGAGGGAGCCTGG - Intergenic
1169674889 20:8142316-8142338 GAATGGAAGGACAAGGAGCAAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170602781 20:17854392-17854414 CAGTGGCAGGAGATTGAGCTTGG - Intergenic
1171085830 20:22237438-22237460 AAGGGGAAGGAGGAGGAGCAGGG - Intergenic
1171311909 20:24151396-24151418 TAGTGGAGGGACAAGGAACCTGG + Intergenic
1171429071 20:25068548-25068570 CAATGGAAGGACAATGAGCAAGG + Intergenic
1172845780 20:37929305-37929327 CTGTGGCAGGAGTAGGAGCAGGG + Intronic
1172885524 20:38228301-38228323 TAGTGGAAGGTGAGGGAACCTGG + Intronic
1173068123 20:39734311-39734333 AAGTGGAAGATGATGGAGCCAGG + Intergenic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1173656623 20:44704196-44704218 CAGGGGATGGTGGAGGAGCCTGG + Intergenic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174061935 20:47839159-47839181 CTGAGGAAAGAGGAGGAGCCAGG + Intergenic
1174069573 20:47890072-47890094 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1174163963 20:48571437-48571459 CAGTGGCCGGAGGCGGAGCCAGG + Intergenic
1174183031 20:48686942-48686964 CCTGGGAAGGAGCAGGAGCCCGG - Intronic
1174195644 20:48770907-48770929 CAGTGGGAGAGGGAGGAGCCTGG + Intronic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1175034335 20:55985354-55985376 CAGTAGAAGCAGCAGGAGACTGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175313500 20:58028279-58028301 CAGTGGGAAGTGAAGGACCCAGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176072592 20:63234835-63234857 CAGTGGGAAGAGAACGGGCCAGG + Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176511828 21:7754592-7754614 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1177112181 21:17041962-17041984 CAGAGGACGTAGAAGGAGACAGG + Intergenic
1177748506 21:25251241-25251263 CAGAGGAAAGAGAAAGAGACAGG - Intergenic
1178645941 21:34385118-34385140 CAGTGAAAGGAGCTGGAGCCCGG - Intronic
1178839484 21:36127419-36127441 CTTTGGAAGGAGAAGAACCCTGG + Intergenic
1179179283 21:39031606-39031628 CAGTGGAGGTAGGAGGTGCCGGG - Intergenic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179411606 21:41167596-41167618 CGGTGGATCGGGAAGGAGCCTGG - Intergenic
1179525616 21:41974160-41974182 CAGTGTAGGGAGATGGAGCCAGG + Intergenic
1179769873 21:43606480-43606502 CAATGGTAGGAAAAGGAGGCAGG + Intronic
1179885727 21:44313532-44313554 CAGTGGATGGAGAGGCAGGCAGG - Intronic
1179967264 21:44814717-44814739 CAGGGCAGCGAGAAGGAGCCTGG - Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181110372 22:20599203-20599225 CAGTGGAGAGAGAAGTTGCCTGG + Intergenic
1181431095 22:22882387-22882409 CAGTAGAGGGAGGAGGAGCCTGG - Intronic
1181462894 22:23095715-23095737 CAGAGGAAAAAGAAGCAGCCCGG + Exonic
1181853625 22:25767399-25767421 CAGTGGAAGTAGCAGCAGCTCGG + Intronic
1182517206 22:30865685-30865707 CAGTGGAAGGTGACCGGGCCAGG + Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183162343 22:36123338-36123360 GAGGGGAATGAGGAGGAGCCGGG + Intergenic
1183208071 22:36433027-36433049 GAGTGGGATGAGAAGGGGCCTGG - Intergenic
1183278083 22:36913864-36913886 CAGTGGATGGGGAGGCAGCCAGG + Intronic
1183529834 22:38347392-38347414 CAGGGGCATGAGCAGGAGCCTGG + Intronic
1184030775 22:41893094-41893116 CTGTGGAAGGACAAGGACCAGGG - Intronic
1184113061 22:42406436-42406458 AAGTGGAAGGAGATGCAGCCAGG - Intronic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184565445 22:45289040-45289062 ACCTGGAAGGAGACGGAGCCAGG - Exonic
1184587799 22:45459535-45459557 GGGTGGAGGGAGAAGGAGCCAGG + Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184651313 22:45920603-45920625 CTGTTGAAGCAGGAGGAGCCTGG + Exonic
1184891847 22:47384530-47384552 CATTGTGAAGAGAAGGAGCCAGG + Intergenic
1185372082 22:50465631-50465653 CAGTAGCAGAAGCAGGAGCCTGG - Intronic
949872032 3:8597021-8597043 CAGTGGAGGGAGAAGGGGCAAGG - Intergenic
949945220 3:9184776-9184798 GGGTGCAAGGATAAGGAGCCAGG - Intronic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950173124 3:10852944-10852966 GAGTGGAATGAGCAGGAGCTGGG + Intronic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950528232 3:13537025-13537047 CAGTGGAGGAAGCAGGAGTCGGG + Intergenic
950798478 3:15530587-15530609 AATTGGGAGGGGAAGGAGCCAGG - Intergenic
951713324 3:25609567-25609589 AAGAGGGAGAAGAAGGAGCCTGG - Exonic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952288260 3:31989104-31989126 AAGAGGAAAGAAAAGGAGCCAGG + Exonic
953775317 3:45811825-45811847 CTTTGGAAGGAGATGGTGCCTGG + Intergenic
955004477 3:54956061-54956083 GAGGGGAGGGAGAAGGAGACAGG - Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
959653652 3:108776372-108776394 CAGTGGGGGGAGAAGGATCCAGG + Intergenic
959660595 3:108863905-108863927 CATTGGCAGGGGGAGGAGCCTGG - Intergenic
960493028 3:118340486-118340508 AAGTGGATGGAGAAGTAGCATGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960942866 3:122945922-122945944 AAGTGGGGAGAGAAGGAGCCGGG + Intronic
960963545 3:123089346-123089368 CAGGGGAAGGAGTGGGAGGCAGG + Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
962265838 3:133943779-133943801 CAGAGGAAGGACAAGGAACTTGG - Intronic
962961581 3:140315957-140315979 TAGTGGAAGGAGAAGCAGTCAGG + Intronic
963119408 3:141763558-141763580 CAGTGGAAGCTGCAGGATCCCGG + Intergenic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
965484135 3:169257923-169257945 CAGTGTAAGAAAAAGTAGCCGGG + Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967357944 3:188594325-188594347 GAGTGGAATGAAAAGGACCCTGG + Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076255 3:195817343-195817365 CCTTGTAAGGAGAAGGAGGCCGG - Intergenic
968076293 3:195817475-195817497 CTGTGTAAGGAGAACGAGGCCGG - Intergenic
968859397 4:3154344-3154366 AAGGGGAAGGAGAAAGAACCAGG + Exonic
969286230 4:6204077-6204099 CAGTGGGATGTGGAGGAGCCTGG - Intergenic
969319811 4:6404892-6404914 CAGTGGAAGGACACGGGGCAGGG - Intronic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
969939903 4:10721732-10721754 CAGGAGAGGGAGAAGGAGCACGG + Intergenic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970324733 4:14911636-14911658 CAGTGGAAGGAAAAGTAGCTTGG - Intergenic
970429376 4:15974789-15974811 CAGTGCAAAGAGAAGGTGCTAGG - Intronic
970520205 4:16875877-16875899 GAGTGGAAGGAGAAGGATAGAGG - Intronic
970678299 4:18477473-18477495 CAGTGGAAGCTGAAGCAGCTGGG + Intergenic
971864682 4:32154301-32154323 ACGTGGCAGGAGAAGGAGCAAGG - Intergenic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
973553429 4:52057983-52058005 AAGTGGACGGAGAATGAGCTTGG - Intronic
973759169 4:54100986-54101008 CAGTGGAGGAAGTGGGAGCCCGG + Intronic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976478362 4:85510665-85510687 CAGTGGAAAAAAAATGAGCCTGG - Intronic
976621457 4:87132382-87132404 CAATGCATGGAGAAGGTGCCTGG - Exonic
977890043 4:102299126-102299148 GAGTGGGAGGAGAAGGGGACTGG - Intronic
979471170 4:121098715-121098737 CTGTAGAAGTAGAATGAGCCTGG - Intergenic
979641870 4:123017752-123017774 CAGTGTAAGGACAAGAAGTCAGG - Intronic
979720299 4:123891926-123891948 CAGTGGAATAAGGAGGAGTCTGG + Intergenic
980093544 4:128466633-128466655 CAGTGGAAGAAGAAGAAGATAGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
980835708 4:138189296-138189318 TTGTGGAATGAGAAGGAGCATGG + Intronic
980995783 4:139778471-139778493 CAGTGGAAGGAGAAAAAGATGGG + Intronic
981001063 4:139829467-139829489 AAGGGGAAGGAGATGAAGCCAGG + Intronic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
981840068 4:149101472-149101494 GAGTGGAATGAGTTGGAGCCAGG + Intergenic
985380158 4:189385295-189385317 CTGTGGAATGACCAGGAGCCAGG + Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985616096 5:922911-922933 CAGTGGGAGGCGGAGGGGCCAGG - Intergenic
985663076 5:1166931-1166953 CAGTGCAGGGAGAAGAAGCATGG + Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
986043245 5:4013174-4013196 CAGTGGACGCAGACAGAGCCCGG + Intergenic
986417902 5:7546834-7546856 CCAAGGAAGAAGAAGGAGCCAGG - Intronic
987088169 5:14488117-14488139 CCCGGGAAGGTGAAGGAGCCGGG - Exonic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
989264928 5:39462558-39462580 CAGTGGATTTAGAGGGAGCCCGG - Intergenic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991965433 5:72086019-72086041 CACTAGAAAGAGAAAGAGCCTGG + Intergenic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992409229 5:76489048-76489070 CAGTGGAAGAACAAGGAGCTGGG - Intronic
992846442 5:80753832-80753854 CAGTGGAAGGAGAAAGAACAGGG + Intronic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993440989 5:87956556-87956578 TGGTGGAAGGAAAAAGAGCCAGG + Intergenic
993512430 5:88788085-88788107 GAATGGAAGGTGAAGTAGCCAGG + Intronic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
994812299 5:104536255-104536277 CAATAGAAGGAGAATGTGCCTGG - Intergenic
995020852 5:107365809-107365831 CATTGGAAGGAGAAGGACTTTGG + Intergenic
997348047 5:133207944-133207966 CAGTAAAAAGAGTAGGAGCCAGG - Intronic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
997606773 5:135180479-135180501 CAGTGGAGGATGAAGGAACCAGG - Intronic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
998017263 5:138742302-138742324 CTCAGGAATGAGAAGGAGCCAGG + Intronic
998165804 5:139842881-139842903 CAGAGGAAGGAGGAGGAGAAAGG - Exonic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999701806 5:154235095-154235117 CTGTGGAAGGACAAGGAACCTGG + Intronic
1000097375 5:157983900-157983922 GAGAGGAAGGAGAAGGAACAGGG + Intergenic
1001141351 5:169146584-169146606 CAGTGGAGGCAGGAGGAGCCGGG - Intronic
1001299930 5:170526123-170526145 AAGTGCAAGGTGGAGGAGCCAGG - Intronic
1001527026 5:172436393-172436415 CTGTGGCCGGTGAAGGAGCCCGG - Intronic
1001628089 5:173153602-173153624 CAGTGGAAGGAGCAGCTCCCTGG + Intronic
1001703742 5:173726480-173726502 AAGTGGAAGGATCATGAGCCTGG + Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001959401 5:175871325-175871347 GAATGGAGGGAGAAGGAGACGGG + Intronic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002569050 5:180129731-180129753 CAGTGGTGGGAGCTGGAGCCTGG - Intronic
1003017388 6:2478862-2478884 CAAGGGAAGGAGAATGGGCCAGG + Intergenic
1003271405 6:4610990-4611012 CAGCGGGAGGGTAAGGAGCCTGG - Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004965426 6:20844158-20844180 CACTGGATGGACAAGAAGCCTGG + Intronic
1005068796 6:21845097-21845119 AAGTGGAAGGAGGGGGAGACTGG - Intergenic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005960422 6:30689453-30689475 CTGTGGAAGGATAAGGGGCTGGG + Intronic
1006002482 6:30976257-30976279 GCGTGGAGGGAGAAGGAGCAGGG + Intergenic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006192745 6:32219714-32219736 CAGAGGCAGTTGAAGGAGCCAGG + Exonic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007905480 6:45455680-45455702 GGGTGGAAGGTGAAGGAGCAAGG + Intronic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1008759400 6:54835467-54835489 CATTGTCAGGAGAAAGAGCCAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011110009 6:83827440-83827462 CATAGGAAGGAGAAGCTGCCAGG + Intergenic
1011502540 6:88006922-88006944 CCCTGGAGGGAGGAGGAGCCTGG - Intergenic
1012259191 6:97067822-97067844 CAGTGGCTGGAGATGAAGCCAGG - Intronic
1012412220 6:98971451-98971473 TAGTGGAAGGAGAGGCAGTCAGG + Intergenic
1013288412 6:108699578-108699600 CAGCGGGAGGCCAAGGAGCCAGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014104835 6:117549883-117549905 CAGTGGAAAGAGAAAGAGCTTGG + Intronic
1014320853 6:119926334-119926356 CAGTTCAAGGACAGGGAGCCTGG - Intergenic
1014677137 6:124380486-124380508 CAGTTGAAGGAGACAGATCCTGG - Intronic
1015054491 6:128883259-128883281 CAGCAGAAGGAGGAGGACCCCGG - Exonic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016154269 6:140784175-140784197 CAGGGGGTGGAGAAGGAGCATGG + Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1018648966 6:165975050-165975072 TGGAGGCAGGAGAAGGAGCCCGG + Intronic
1018950177 6:168373984-168374006 CCAGGGAAGGAGAAGGAGCTGGG + Intergenic
1019175867 6:170159287-170159309 CAGTGGCAGGTGAAGGGGCTGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021842171 7:24729657-24729679 GACTGGAGGTAGAAGGAGCCTGG + Intronic
1022022087 7:26410361-26410383 CAGTGTAAGAAGAAAGAACCAGG - Intergenic
1022482637 7:30753862-30753884 AAGTGGCTGAAGAAGGAGCCGGG + Exonic
1022605999 7:31814829-31814851 CAGTAGAAGGTTAAGTAGCCTGG + Intronic
1023029859 7:36082363-36082385 AACTGGAAGAAGGAGGAGCCAGG - Intronic
1023514755 7:40990752-40990774 AAGTGAAAGGTGAAGGAGCAAGG - Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023706027 7:42942633-42942655 CAGTGTAAGGAGAATGTGCTGGG + Intronic
1024222106 7:47297183-47297205 ATGTTGAAGGACAAGGAGCCGGG - Exonic
1025232524 7:57212005-57212027 CTGAGGAAAGAGGAGGAGCCAGG - Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1025769921 7:64495073-64495095 CAGGGGAAGGAGGAGGGGCGGGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1026261023 7:68755485-68755507 CAGTGGAAGGCAAGGGGGCCAGG + Intergenic
1026688497 7:72532983-72533005 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026723731 7:72854874-72854896 CAGTGGAAGGCCAAGGAGGAAGG - Intergenic
1026845179 7:73694784-73694806 CAGTGGAGTGAGGAGCAGCCAGG - Intronic
1027832604 7:83199140-83199162 CAGTGGAAGAAGGAGGGGCAAGG + Intergenic
1029424371 7:100486990-100487012 GAGTGGCAGGAGAGGGAGCGTGG - Exonic
1029745718 7:102514757-102514779 CTGTGGAAGGAGGAGGACCAGGG + Intronic
1029763657 7:102613736-102613758 CTGTGGAAGGAGGAGGATCAGGG + Intronic
1032019640 7:128400216-128400238 CAGGTGAGAGAGAAGGAGCCAGG + Intronic
1032718015 7:134527530-134527552 CAGTGGGAGGAGTTGGAGCCTGG - Intergenic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1032938419 7:136760858-136760880 CAGTGGAAGGTGAAGGGGAGTGG - Intergenic
1032945694 7:136849748-136849770 CAGGGGAAGGAGGAGAAGACAGG + Intergenic
1033134595 7:138773987-138774009 GCCTGGGAGGAGAAGGAGCCGGG - Intronic
1033544974 7:142391602-142391624 CAGTGGAGGGTGAAGGGGCTGGG + Intergenic
1033550752 7:142445431-142445453 CAGTGGATGGTGAAGGGGCTGGG + Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034138177 7:148791188-148791210 AAGTGGAAGTAGAAAGAGCTTGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1035209827 7:157319541-157319563 GACTGGAAGGAAAGGGAGCCAGG + Intergenic
1035598438 8:880163-880185 CAGTGGAGGGAGAAGGGGCGGGG - Intergenic
1036483140 8:9154861-9154883 CCGTGGAAAGAGAGGGAGACGGG + Intronic
1036634362 8:10538738-10538760 CAGGGGACAGAGCAGGAGCCAGG - Exonic
1037234106 8:16696210-16696232 GAAGGGAAGGAGAAAGAGCCAGG - Intergenic
1038378896 8:27073652-27073674 CAGTGGAAAGAGCAGGAACTTGG + Intergenic
1038450860 8:27637907-27637929 CAGGGGCACGGGAAGGAGCCAGG + Intronic
1039938271 8:42066940-42066962 AAGTGGTGGGAGAAGGAGGCAGG + Intergenic
1040110985 8:43567133-43567155 CCGTGGAAGGAGAGGAGGCCAGG - Intergenic
1041277706 8:56179991-56180013 CAGAGGCAGAATAAGGAGCCAGG + Intronic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041401303 8:57448224-57448246 GTTTGCAAGGAGAAGGAGCCTGG - Intergenic
1041529971 8:58854521-58854543 CAATGGAAGGAGAAGAAGGTGGG + Intronic
1041718886 8:60958166-60958188 GAGTGCAATGAAAAGGAGCCCGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1043695076 8:83207894-83207916 CTGTGGAGTCAGAAGGAGCCAGG + Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044533964 8:93338783-93338805 TGGTGCAAGGAGCAGGAGCCAGG - Intergenic
1044973003 8:97638188-97638210 CAGTGGAAGGAGAAGGAACTAGG + Intergenic
1045011335 8:97961464-97961486 CACTGGCAGACGAAGGAGCCCGG - Exonic
1045252890 8:100496128-100496150 GAGTGGAAGGAGAAGGGGCTGGG + Intergenic
1045698086 8:104833986-104834008 CAGCAGAAGGAGAAGGAACATGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045815394 8:106271232-106271254 TAGTAGACGGAGGAGGAGCCAGG - Intronic
1046813920 8:118563360-118563382 CAATGGAATGAGAAGGGGACTGG - Intronic
1047367222 8:124222648-124222670 CAGTGGAAGGAGAGGGTAACAGG - Intergenic
1047586129 8:126275144-126275166 CAATGGATGGAGAAGGAGATGGG - Intergenic
1047958555 8:129994326-129994348 CAGTCCAAGGCGAAGGTGCCGGG - Intronic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1048518916 8:135136116-135136138 GAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1048971382 8:139646932-139646954 CAGTGTTAGGACAGGGAGCCAGG - Intronic
1049236135 8:141513311-141513333 CAGCGGAGGGAGCTGGAGCCTGG + Intergenic
1049343827 8:142128037-142128059 CACAGGAAGGAGGAGCAGCCTGG - Intergenic
1049397515 8:142408164-142408186 CTGTGGAATGAGGAGGAGCCAGG - Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049492726 8:142913756-142913778 CAATGGAAGCAGAGGGAGCTGGG - Intronic
1049676470 8:143891476-143891498 CAGTGGCTGGAGGAGGGGCCCGG - Intergenic
1049884010 9:15908-15930 CAGCAGAAGGAGCAGGAGCAAGG - Intergenic
1050135688 9:2461368-2461390 CAGTGGAAGGTGGTGGAGTCAGG + Intergenic
1050203486 9:3173894-3173916 TCGTGGAAGGAGAAGGAGGAGGG + Intergenic
1051750496 9:20336435-20336457 CATTGGAATGAAAGGGAGCCAGG - Intergenic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053316453 9:37055983-37056005 GACTTGAAGGAGAAGGAGCTGGG - Intergenic
1055486878 9:76764810-76764832 CAGTGGAGGGAGAAGGATCATGG - Intronic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1056822249 9:89851506-89851528 CTATGGATGGAGAAGAAGCCAGG + Intergenic
1057040505 9:91844353-91844375 CTGTGGAAGGTGCAGGAGCGTGG - Intronic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058976237 9:110127673-110127695 GACAGGAAGGAGAAGGAGCTGGG - Intronic
1059290778 9:113221774-113221796 CCGCGGAAGGAGAAAGAGCTCGG + Intronic
1059708419 9:116845085-116845107 CAGTGGAGAGAGCAGGGGCCTGG - Intronic
1060044994 9:120332874-120332896 AAGTGGAAGTTGAAGGAGCCGGG - Intergenic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1060409302 9:123389519-123389541 CTGTGGAAGTGGCAGGAGCCAGG - Intronic
1185449551 X:275204-275226 GAGAGGATGGAGAAGGAGCAGGG + Intergenic
1185889380 X:3810775-3810797 CTGTCCAAGGAGAAGGACCCTGG - Intergenic
1186463477 X:9766084-9766106 AAGTGGAAGGAGAAGCAGAAAGG + Intronic
1187059108 X:15768899-15768921 AAGTGCAAGGAAAAGGAGCTGGG + Intronic
1187576224 X:20559173-20559195 CAAGGGAAGGAGAAGGAGAAGGG - Intergenic
1187696680 X:21929520-21929542 CAGGGGAAGGAGTAGGAGCCAGG + Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1190049047 X:47135765-47135787 CAGTTGAAGGCGCAGGACCCAGG - Intergenic
1190224941 X:48538107-48538129 CAGTTGAAAGAGAAGTGGCCAGG - Intergenic
1190254416 X:48751885-48751907 CAGTGGATGGGGAAGAAGCACGG + Intergenic
1190681574 X:52830930-52830952 CTGTGGAGGCAGCAGGAGCCAGG + Intergenic
1190726761 X:53194998-53195020 CGGTGGATGGAGAAGGAGCTGGG - Exonic
1192190057 X:68985565-68985587 CAGTGGGAGGAGAAGGACAGGGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194518350 X:94887696-94887718 CAGTGGCAGAAGAAGGTCCCAGG + Intergenic
1194996724 X:100599262-100599284 CATTGGAAGGAGAACGATCATGG + Intronic
1195282329 X:103348318-103348340 CGCTGGAAGGGGAAGGGGCCGGG - Intergenic
1195310958 X:103631309-103631331 CAGTGGAAGGATCAGGACCCAGG - Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1196434746 X:115664792-115664814 CAGTGGCAGGAGATGGAGCAGGG - Intergenic
1196871857 X:120120235-120120257 AGGTGGAAGGAGGAGGAGGCAGG + Intergenic
1197656545 X:129122804-129122826 CAGTTGAAGGAAAAAGTGCCAGG - Intergenic
1198605417 X:138332051-138332073 TTGTGGAAGGAGAAGAGGCCAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200229132 X:154435392-154435414 CAGTGGAAGGAGTAGATGCTGGG - Exonic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200763494 Y:7061607-7061629 TAGGGGAAGGAGAAGGAGAGGGG - Intronic
1200834295 Y:7717961-7717983 CAGGGGAAAGAGAAGAAGTCTGG - Intergenic
1201963590 Y:19708001-19708023 CGGTGGATGGAGAAGGCGCTGGG - Exonic
1202411958 Y:24583465-24583487 TTGTGCAAGGAGGAGGAGCCTGG - Intergenic