ID: 1107838582

View in Genome Browser
Species Human (GRCh38)
Location 13:44433104-44433126
Sequence TAGGATCAAAAGACGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107838582_1107838585 10 Left 1107838582 13:44433104-44433126 CCAACTTCCGTCTTTTGATCCTA 0: 1
1: 0
2: 0
3: 11
4: 109
Right 1107838585 13:44433137-44433159 TTCCAATTATACACAGAATAAGG 0: 1
1: 0
2: 1
3: 18
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107838582 Original CRISPR TAGGATCAAAAGACGGAAGT TGG (reversed) Intronic
911142800 1:94524204-94524226 AAGGATCAAAAGACAGACCTGGG - Intergenic
912176014 1:107158022-107158044 TAGGAACAAAAGACAGAAGCAGG - Intronic
912488746 1:110049491-110049513 TAGGATCAAAGGAATGCAGTTGG - Exonic
921363203 1:214349504-214349526 AAGCATCAAAATACTGAAGTAGG + Exonic
923110239 1:230884436-230884458 TAGGATCATGAGAGGGATGTAGG + Intergenic
1067149270 10:43716512-43716534 TAAAATTCAAAGACGGAAGTGGG - Intergenic
1068336588 10:55640729-55640751 TAGGGTAAAAAGACTAAAGTGGG + Intergenic
1070513032 10:77178371-77178393 TAGGATTTAAAGAAGGGAGTAGG - Intronic
1072119265 10:92391988-92392010 AAGGATCAAAACAAGGAAATTGG - Intergenic
1073857147 10:107690184-107690206 TGGGATCAAAAGAGGGAGGAAGG + Intergenic
1075698358 10:124451853-124451875 TAGGATCAAAAGGGTGAAGGGGG - Intergenic
1077760538 11:5091411-5091433 TAGAATCAGAAAAAGGAAGTAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1087271256 11:96114364-96114386 TAGGATCAAACGATGAAATTAGG - Intronic
1089016499 11:115169476-115169498 TAGGAGCAAAAAACCCAAGTAGG + Exonic
1092998067 12:13969365-13969387 TAGAATCAGAAGATGTAAGTTGG + Intronic
1096365229 12:51023721-51023743 TAGGATTTAAAGTTGGAAGTTGG - Intronic
1098377172 12:69829285-69829307 TATTATCAAAAGAGGGCAGTGGG + Intronic
1107838582 13:44433104-44433126 TAGGATCAAAAGACGGAAGTTGG - Intronic
1112491831 13:99872702-99872724 TAGCATCAAAGGAGGGCAGTTGG + Intronic
1115488135 14:33932512-33932534 TAGCATGAAAACACGGAACTAGG + Intronic
1120164530 14:81182059-81182081 TAGGATCAATAAATGGAAGTTGG - Intronic
1120206956 14:81597257-81597279 TAGGATCAAAAGAACTGAGTGGG - Intergenic
1122392510 14:101399883-101399905 AAGGAAGAAAAGAAGGAAGTAGG + Intergenic
1122972838 14:105159292-105159314 TAGGAGCACAGGATGGAAGTGGG + Intronic
1125799507 15:42432944-42432966 TAAAATCAAAAGACAGAAATTGG - Intronic
1125916043 15:43488411-43488433 TGGGTGCAAAAGACGGAGGTAGG + Intronic
1126446916 15:48757608-48757630 TAGTGTCAAAAGACAGAACTGGG + Intronic
1126937799 15:53730631-53730653 TAGGAAGAAGAGAAGGAAGTCGG - Intronic
1130160327 15:81392428-81392450 TAGGATCCTCAGACGGAAGAAGG + Intergenic
1136618419 16:31412382-31412404 GAGGATCAGAAGACAGAAATTGG - Intronic
1141746171 16:85927892-85927914 TAGGATCAAGAAAGGGAAGGAGG + Intergenic
1145192417 17:20855228-20855250 TAGGATAAAAAGACTAAAGTGGG + Intronic
1145402933 17:22558282-22558304 TAGGATAAAAAGACTAAAGTGGG + Intergenic
1146738450 17:35260148-35260170 TTGGTTCAAAAAATGGAAGTGGG - Intronic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1150553378 17:66231437-66231459 TAGGATGAAAAGAAGGAGGAAGG - Intronic
1152242176 17:79166429-79166451 CAAGATCAAAAGACTTAAGTAGG + Intronic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1157437199 18:47680766-47680788 TAGCAGCAAAAGACAGCAGTGGG - Intergenic
1163271807 19:16258972-16258994 CAGGATCAAAGGAGGGATGTGGG - Intergenic
939184209 2:138841344-138841366 TAGGAGCAAAAAAAGGAAGTTGG - Intergenic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
940481472 2:154237424-154237446 AAGGAACAAATGATGGAAGTGGG - Intronic
940547789 2:155111252-155111274 TACTATGAAAAAACGGAAGTTGG + Intergenic
941169672 2:162121246-162121268 CAGGATCAATAGACTGAAGACGG + Intergenic
942052509 2:172153378-172153400 GAGGATCAAAGGACGACAGTCGG - Intergenic
942629227 2:177938089-177938111 TAGGATAAAAGGAAGGATGTAGG + Intronic
947671802 2:231941741-231941763 TACGATCACAAGATGGGAGTAGG - Intergenic
948795095 2:240398670-240398692 TAGGACCCAAAGGCGGAAGGAGG + Intergenic
1168973329 20:1945863-1945885 TATCCTCAAAAGAGGGAAGTAGG + Intergenic
1171186136 20:23125688-23125710 CAGGAGCAAAAAAAGGAAGTCGG + Intergenic
1174722284 20:52825766-52825788 TACGAGCAAGAGACGGAACTAGG + Intergenic
1179277624 21:39906598-39906620 TAGGAAGAAAAGACGGAGGGAGG - Intronic
1183204629 22:36410179-36410201 TAGGCTAATGAGACGGAAGTGGG - Intergenic
957311041 3:78519369-78519391 TTAGATCAAAAGTCTGAAGTTGG + Intergenic
958652443 3:96954461-96954483 TAGGATCAAAAAACATAACTTGG - Intronic
962966456 3:140358741-140358763 TGGGATCAAAATAAGGGAGTTGG - Intronic
962996103 3:140630177-140630199 AGGAATCAAAAGATGGAAGTAGG + Intergenic
963938111 3:151075179-151075201 AAGGATGACAAGAAGGAAGTAGG + Intergenic
967947798 3:194817963-194817985 TAGGATCAATGGAGGGTAGTGGG + Intergenic
969893653 4:10282697-10282719 GGGGATCAAAAGACAGAAGTGGG - Intergenic
971548838 4:27922990-27923012 GAGGATCAAAAAACTGATGTTGG + Intergenic
974370269 4:61007591-61007613 GAGGATGAAAAGAGGGAGGTAGG + Intergenic
976908424 4:90268619-90268641 AAGGAAGAAAAGAAGGAAGTGGG + Intronic
977063040 4:92279047-92279069 TGGGTACAAAAGACGTAAGTAGG - Intergenic
977090260 4:92664905-92664927 TTGGATCCAAAGACAGAAATAGG - Intronic
978533056 4:109733295-109733317 TGGGAAGAAAAGATGGAAGTGGG - Intergenic
979762140 4:124419462-124419484 TAGGAACAAAATAAGGAAATTGG + Intergenic
980060882 4:128128073-128128095 TACAAACAAAAGAAGGAAGTTGG + Intronic
984046919 4:174812828-174812850 TAGGAAAAAAAGACGGAGGAAGG - Intronic
984998844 4:185465024-185465046 TACCATGAAAAGAGGGAAGTAGG - Intronic
987637457 5:20563997-20564019 TTTGATCAAAAGATAGAAGTAGG - Intronic
993080841 5:83298334-83298356 TAGGATAAACAGAGGGAAATGGG - Intronic
993248378 5:85482492-85482514 TAGGATGAAAAGAAAGAAGTGGG + Intergenic
993362967 5:87000960-87000982 TGGAATCAAAGGATGGAAGTAGG - Intergenic
995859285 5:116624732-116624754 TAGCCTCAAAAGAGAGAAGTAGG - Intergenic
996765660 5:127031694-127031716 TAGAATCAAAAGCAGGGAGTTGG + Intergenic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
997999476 5:138612798-138612820 TTGGATAAAAATACAGAAGTGGG + Intronic
998261302 5:140633701-140633723 TAGGTTCAAGAAAAGGAAGTTGG + Exonic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001292216 5:170471753-170471775 GAGGATCTAAAGGAGGAAGTAGG - Intronic
1002704000 5:181148206-181148228 AAGGATCGAGAGAGGGAAGTGGG - Intergenic
1003887615 6:10535395-10535417 TAAGGGTAAAAGACGGAAGTGGG - Intronic
1005500614 6:26426141-26426163 AAGGAAAAAAAGAGGGAAGTAGG - Intergenic
1005701242 6:28402478-28402500 TAGTGTCAAAAGACGGAGATTGG - Intergenic
1007008144 6:38387234-38387256 TAGGATAATAAGACAAAAGTTGG + Intronic
1007833410 6:44655958-44655980 CAGGGACAGAAGACGGAAGTGGG + Intergenic
1008015819 6:46518450-46518472 TGGGATAAAAATATGGAAGTGGG + Intergenic
1009434163 6:63599329-63599351 TAGGAAAAACAGACTGAAGTAGG + Intergenic
1010793754 6:80095273-80095295 AAGGATCAAAAGCCATAAGTAGG - Intergenic
1010971858 6:82271638-82271660 TATGATAAAAAGTCGGAAGATGG + Intergenic
1012869538 6:104657186-104657208 TAGGCTGAAATGACAGAAGTAGG + Intergenic
1013500656 6:110747077-110747099 TATGATCAAAAGACAAAACTTGG - Intronic
1014398680 6:120959702-120959724 TAGAATGAAAAGACGTAAATGGG - Intergenic
1014827557 6:126063923-126063945 TTGGATCAAAACAGGGAAGTGGG + Intergenic
1016791051 6:148067186-148067208 TATAATCTAAAGAGGGAAGTAGG + Intergenic
1020412791 7:7911868-7911890 AAGGATCAAAAGAGAGAGGTTGG - Intronic
1023705266 7:42933966-42933988 TAAGATCAAAAGAAGTATGTGGG + Intronic
1028737714 7:94236285-94236307 TAGGCTTTAAAGATGGAAGTAGG + Intergenic
1033103527 7:138498130-138498152 CAGGATCAAGAGGCTGAAGTGGG - Intronic
1035120870 7:156565504-156565526 AAGGAGCAAAGGAAGGAAGTGGG + Intergenic
1037547586 8:19939594-19939616 GAGGATGAGAAGAAGGAAGTTGG + Intronic
1038149990 8:24934339-24934361 TGGGAGCAAAAGACAGAAGGTGG - Intergenic
1040652393 8:49464303-49464325 TAGGACCAAAAGATGGAGGCAGG - Intergenic
1044321630 8:90808601-90808623 TAGGATGAAAAAATGGAAATAGG - Intronic
1045348357 8:101315426-101315448 TGGGATCAACAGATGGAAATAGG + Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1047278623 8:123425562-123425584 TAGGCTTAAAATACGGAAGTTGG - Intronic
1058309095 9:103478588-103478610 TAGGAAAAAAAGAAGGAAGGAGG - Intergenic
1058914261 9:109550456-109550478 TAGCAGCAAAAGAGGGGAGTGGG + Intergenic
1189224105 X:39398334-39398356 GAGGAGCAAAGGACGGAAGAAGG - Intergenic
1189438187 X:41011107-41011129 TAAGCTCAAAAGATGGAAGAGGG + Intergenic
1189895154 X:45647787-45647809 TAGGATAAAAACAATGAAGTTGG + Intergenic
1189948149 X:46201784-46201806 CAAGATCAACAGAAGGAAGTTGG - Intergenic
1193992355 X:88323609-88323631 TAGTATCAGAAGAGGGAAGGTGG - Intergenic
1197686425 X:129444059-129444081 TAGAATCAAAAGAAGGCAGGTGG - Intergenic
1198032925 X:132771587-132771609 TAGGCTCAAAAGAAGGAAATGGG + Intronic