ID: 1107842711

View in Genome Browser
Species Human (GRCh38)
Location 13:44475916-44475938
Sequence CTGGAGACTGCCACTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107842711_1107842713 4 Left 1107842711 13:44475916-44475938 CCAACAAAAGTGGCAGTCTCCAG 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1107842713 13:44475943-44475965 AATGACAAAACCTTAGTACATGG 0: 1
1: 0
2: 1
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107842711 Original CRISPR CTGGAGACTGCCACTTTTGT TGG (reversed) Intronic
900360639 1:2287210-2287232 CTGGAGACTGCCATTTTGTGTGG + Intronic
905019462 1:34798398-34798420 CTGGAGAATGCTAGGTTTGTTGG + Intronic
906964518 1:50443347-50443369 CTGAAGAAAGCCACTTTTCTTGG - Intronic
912011297 1:104966762-104966784 CTGGAGAGAGACACTTTTGCTGG - Intergenic
914393951 1:147247054-147247076 CTGGAGACTTCCTCTTTTGATGG + Intronic
920928219 1:210362884-210362906 CTGGAGACTGACACTTTATTTGG + Exonic
921400361 1:214715347-214715369 CTAGAGACAGTGACTTTTGTTGG + Intergenic
1064738424 10:18407593-18407615 CTGGAAACTGCCCCTTTTTTTGG + Intronic
1065115434 10:22478655-22478677 CTGGGGACAGCCATTTTGGTGGG + Intergenic
1070436163 10:76396123-76396145 CTGGAAGCTGCCACGTTTGAAGG + Intronic
1072627975 10:97126408-97126430 TTGGACTCTGCCACTTTTGGTGG - Intronic
1074565317 10:114572443-114572465 CTGGAGCCAGCCACATTTGTGGG - Intronic
1077187535 11:1242035-1242057 CTGGAGGTTGCCATTGTTGTTGG - Exonic
1078983663 11:16567432-16567454 GTGGAGACTGCCACGGTTGGTGG + Intronic
1082835192 11:57646250-57646272 ATGGGGACTGCCACTTTAGAGGG + Intronic
1083706503 11:64520058-64520080 TTGGAGACTGCCGGTTTTGTTGG - Intergenic
1093300875 12:17452687-17452709 CTTGAGAGTGGCACTTTTGCAGG + Intergenic
1097188661 12:57209208-57209230 CTGGGGACTGCGACTTATGCCGG - Intronic
1097492169 12:60283533-60283555 TTAGAGACTGCCACATTTCTTGG + Intergenic
1097915576 12:65017456-65017478 CTGGAGCTTGCCACTTGAGTAGG + Intergenic
1098212487 12:68181280-68181302 CTGTAGACTGACACTGTTGGTGG + Intergenic
1099099726 12:78423634-78423656 TTGGAGACTTCCATTTTTATAGG + Intergenic
1101731608 12:107431657-107431679 CTGCAAACTGTGACTTTTGTGGG + Intronic
1105646585 13:22325610-22325632 CTACAGACTGCCTCTTTGGTAGG - Intergenic
1107203517 13:37752393-37752415 CAGGTGACTGCCATTTCTGTAGG + Intronic
1107408799 13:40139638-40139660 TTGGAAACTGCCATTTTTATGGG - Intergenic
1107842711 13:44475916-44475938 CTGGAGACTGCCACTTTTGTTGG - Intronic
1108644771 13:52416273-52416295 CTGGGTACTTCAACTTTTGTAGG - Intronic
1111132099 13:83990545-83990567 GTGTTGACTGTCACTTTTGTTGG + Intergenic
1114247351 14:20927225-20927247 CTTGAGACTGACAGTCTTGTGGG - Intergenic
1115785003 14:36815652-36815674 CTGGAAACTTCCACATTTGGAGG - Intronic
1120105067 14:80484591-80484613 CTGGTGATTGCCACTTTGATAGG + Intronic
1120388232 14:83872729-83872751 CAGGAGACTGCCACTACTCTTGG + Intergenic
1122759851 14:104015316-104015338 GTGGAGACTGCCTCTGCTGTAGG + Intronic
1128913278 15:71536270-71536292 CTGGAGGCTGCCACATTCCTTGG + Intronic
1129474742 15:75777429-75777451 CCTGAGACAGCCACTTTTGGTGG + Intergenic
1130027889 15:80285585-80285607 CTGGAGCCTGCCCCTTGTGCAGG - Intergenic
1130324356 15:82867311-82867333 GTGAAGTCTGTCACTTTTGTGGG - Intronic
1133379281 16:5316391-5316413 CTGGAGACTGCCCATGTTCTGGG - Intergenic
1133508335 16:6433725-6433747 CTGGGGACTGCCACTTTCCTTGG + Intronic
1134061545 16:11202484-11202506 CATGAGATTGCCATTTTTGTGGG - Intergenic
1143092365 17:4456479-4456501 CTCACGACTGACACTTTTGTGGG + Intronic
1143413302 17:6725891-6725913 CTTGAGATTGCTACTTGTGTGGG - Intergenic
1144276384 17:13672429-13672451 CTGGAGGGTGCTCCTTTTGTGGG - Intergenic
1149375000 17:56034902-56034924 CTAGAGGCTGCCACATTTCTTGG + Intergenic
1152609942 17:81310436-81310458 CAGGAGAGTGCCACCTTCGTGGG + Intergenic
1152934265 17:83126922-83126944 CTGAAGACTGTCATTTTTGAAGG + Intergenic
1155137314 18:23008618-23008640 CTGGAATCTGCCATTTTTCTTGG + Intronic
1157662465 18:49457929-49457951 CTAGAGGCTGCCACTTTCCTTGG - Intronic
1160522388 18:79515380-79515402 CTGGAGACCACCACTCCTGTGGG - Intronic
1166871756 19:45875370-45875392 CTGGTGTCTGTCACTTTTGCAGG + Intergenic
1167008044 19:46788068-46788090 CTGGAGACTGGAACTTTGGAGGG + Exonic
926964208 2:18392248-18392270 CTGGTGACAGCCACTTTTCCAGG + Intergenic
931303137 2:61000844-61000866 CTGGAGATTGCAAATTTTTTTGG - Intronic
932066089 2:68562385-68562407 CTGGAGAGAGATACTTTTGTAGG + Intronic
934926990 2:98388948-98388970 CTGGAGACTGCCTTTTTGTTGGG - Intronic
943507870 2:188784456-188784478 CTGGAGAGTTTCACTGTTGTTGG + Intronic
944484660 2:200192427-200192449 CTGGAGACTGCCACATTTCTGGG + Intergenic
947074882 2:226331796-226331818 CAGGAGTCTTTCACTTTTGTGGG - Intergenic
947100847 2:226619832-226619854 CTGGAGGCTCCCTCTTTTCTAGG - Intergenic
1169153046 20:3305620-3305642 CTGGAGACTGCAAGCTTTGAGGG + Intronic
1170491155 20:16876224-16876246 CAGGAGACTGCTATATTTGTTGG + Intergenic
1173111773 20:40197669-40197691 CTGGAGTCTGAGCCTTTTGTGGG - Intergenic
1176027325 20:62992752-62992774 CTGGAGACTGCTGCCTGTGTGGG - Intergenic
1184755761 22:46514957-46514979 TTGGACAGAGCCACTTTTGTGGG - Intronic
950305716 3:11914307-11914329 CTGCAGACTCCCACTTTGCTGGG - Intergenic
952498982 3:33941723-33941745 CATGAAACTGCCATTTTTGTAGG - Intergenic
955043904 3:55341934-55341956 CTGGAGAATGTCACTGTTGCTGG - Intergenic
955787757 3:62557860-62557882 CATGTGACTGCCATTTTTGTAGG + Intronic
959286826 3:104425292-104425314 CTTGTGATTGCCTCTTTTGTAGG + Intergenic
967102559 3:186228310-186228332 CTGGGGATTGCCTCTTTTCTGGG + Intronic
971258956 4:25038944-25038966 CTGAAGACTGCTAATTTGGTGGG + Intergenic
972690180 4:41389491-41389513 CTGGGGACTGCCCCGTCTGTGGG + Intronic
974247737 4:59342653-59342675 CTGGAGGCTACCATTCTTGTTGG + Intergenic
974297465 4:60020545-60020567 CCTGAGACTGCCACTTCTGGTGG + Intergenic
977842581 4:101726465-101726487 CTCCAGACTGCAAATTTTGTTGG + Intronic
979127894 4:116999304-116999326 CTGGAGACTATCTTTTTTGTTGG - Intergenic
982636151 4:157899342-157899364 CAGTAGACTTCCAGTTTTGTGGG + Intergenic
983712338 4:170734292-170734314 CTGGAGATTGCCACCATTCTAGG + Intergenic
984970940 4:185189254-185189276 CTTGATGTTGCCACTTTTGTAGG - Intronic
986789187 5:11143969-11143991 CTGGGGACTGCCCCTATGGTAGG - Intronic
988921062 5:35943161-35943183 TTGGAGCCTGTTACTTTTGTTGG - Intergenic
990950478 5:61293448-61293470 CTGGAAGCAGCCACTTTGGTAGG - Intergenic
992101643 5:73413533-73413555 TATGAAACTGCCACTTTTGTAGG + Intergenic
993076910 5:83243638-83243660 CTGTAGAGTGCCTCTTCTGTTGG - Intronic
997868135 5:137482797-137482819 CTGGAGACTGTCAGTTCTCTTGG + Intronic
998877940 5:146619224-146619246 GTGGAAACTGCCCCTTTTATAGG - Intronic
999042257 5:148427515-148427537 CTGGACACATCCACTTCTGTAGG - Exonic
1000699688 5:164433384-164433406 GTGGCGACTTCCAGTTTTGTTGG - Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003713014 6:8614492-8614514 TTGGAGACTGCCACATTCCTGGG - Intergenic
1005354723 6:24971142-24971164 ATGGTGACTGCCACTCTTGCTGG - Intronic
1005758032 6:28943195-28943217 CTGGTGACTGTTTCTTTTGTTGG + Intergenic
1006389976 6:33752441-33752463 CCTGAGCCTGCCACTCTTGTTGG + Intergenic
1011215401 6:85000211-85000233 CACAATACTGCCACTTTTGTTGG + Intergenic
1012167496 6:95976052-95976074 CTTGAGACTGCCAATCTTGTAGG - Intergenic
1013060279 6:106626948-106626970 CTGGAGACGGCCACTACTGTTGG - Intronic
1014169053 6:118257569-118257591 TTTGAAACTGCCACATTTGTAGG - Intronic
1014791111 6:125673454-125673476 CAGGGTAGTGCCACTTTTGTTGG - Intergenic
1018670233 6:166170844-166170866 CTGGATTCTGCCATCTTTGTAGG - Intergenic
1019757272 7:2781125-2781147 CTGGATACTCACACCTTTGTAGG + Intronic
1025032315 7:55567871-55567893 CCAGGGACTGCCACATTTGTTGG + Intronic
1028163770 7:87514929-87514951 CTGGCTACTTCCATTTTTGTTGG + Intronic
1032607128 7:133367647-133367669 CTGGAGACTGTCCCTTTTTAGGG - Intronic
1033682910 7:143613571-143613593 ATAGAGTCTGCTACTTTTGTTGG - Intergenic
1033701701 7:143844071-143844093 ATAGAGTCTGCTACTTTTGTTGG + Intergenic
1043159166 8:76824362-76824384 TTGCAGACTGCCACATTTGTAGG + Intronic
1044695056 8:94914491-94914513 CTGGGGTGTGCCACTATTGTTGG - Intronic
1045882156 8:107053845-107053867 CAGGAGACTGCCAGTTGTATTGG + Intergenic
1047890779 8:129306340-129306362 CATGAGACTGCCAGTTTTGGGGG + Intergenic
1050815446 9:9806273-9806295 CGGGAGACTGCCTTTTTTTTTGG - Intronic
1051367084 9:16328883-16328905 CTGGATAGTGCCATTTTTGGAGG + Intergenic
1055644956 9:78354755-78354777 AAGGAGACTGACATTTTTGTAGG - Intergenic
1057024004 9:91722275-91722297 CTGGAGCCTGGCACTTCTGGGGG - Intronic
1057050317 9:91918523-91918545 TAGGAAACTGCCATTTTTGTAGG + Intronic
1060235050 9:121856949-121856971 CTGGAGACAGCCACCTTCTTAGG - Intronic
1060643697 9:125260579-125260601 CTGGAGACTCCCAGTATTGGAGG + Intergenic
1188533086 X:31163964-31163986 CTGGAGGCTGCCATCTTTCTTGG - Intronic
1188574435 X:31629801-31629823 CATGAAACTGCCACTTTTATAGG - Intronic
1189054719 X:37686465-37686487 CAAGAAACTGCCATTTTTGTTGG - Intronic
1192245986 X:69371940-69371962 TAGGAAATTGCCACTTTTGTAGG - Intergenic
1197456186 X:126678303-126678325 TTGCAGATTGCCAGTTTTGTTGG + Intergenic
1199530117 X:148837161-148837183 CTGTACACTGTCACTATTGTTGG - Intronic
1199777273 X:151023681-151023703 CTGGGGACTGCCCAGTTTGTGGG - Intergenic
1200084410 X:153596395-153596417 ATGCAGACTTCCCCTTTTGTAGG + Intronic
1200702498 Y:6414065-6414087 CTGAAGAGTGACACTTTTGCAGG + Intergenic
1201031613 Y:9750633-9750655 CTGAAGAGTGACACTTTTGCAGG - Intergenic