ID: 1107843739

View in Genome Browser
Species Human (GRCh38)
Location 13:44488859-44488881
Sequence CTGAATCTACAGATGAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2466
Summary {0: 1, 1: 13, 2: 53, 3: 400, 4: 1999}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107843739_1107843741 -2 Left 1107843739 13:44488859-44488881 CCCAAATTCATCTGTAGATTCAG 0: 1
1: 13
2: 53
3: 400
4: 1999
Right 1107843741 13:44488880-44488902 AGCAGTATTCTTAAATCCAATGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107843739 Original CRISPR CTGAATCTACAGATGAATTT GGG (reversed) Intronic
Too many off-targets to display for this crispr