ID: 1107843739 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:44488859-44488881 |
| Sequence | CTGAATCTACAGATGAATTT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2466 | |||
| Summary | {0: 1, 1: 13, 2: 53, 3: 400, 4: 1999} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1107843739_1107843741 | -2 | Left | 1107843739 | 13:44488859-44488881 | CCCAAATTCATCTGTAGATTCAG | 0: 1 1: 13 2: 53 3: 400 4: 1999 |
||
| Right | 1107843741 | 13:44488880-44488902 | AGCAGTATTCTTAAATCCAATGG | 0: 1 1: 0 2: 0 3: 21 4: 201 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1107843739 | Original CRISPR | CTGAATCTACAGATGAATTT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||