ID: 1107844054

View in Genome Browser
Species Human (GRCh38)
Location 13:44492681-44492703
Sequence CTGGAGGAATGGTGGAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 492}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107844043_1107844054 16 Left 1107844043 13:44492642-44492664 CCCCCTCCAAACAAAAAAAAATC 0: 1
1: 3
2: 67
3: 1418
4: 16222
Right 1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG 0: 1
1: 0
2: 1
3: 36
4: 492
1107844042_1107844054 17 Left 1107844042 13:44492641-44492663 CCCCCCTCCAAACAAAAAAAAAT 0: 1
1: 2
2: 108
3: 1031
4: 8656
Right 1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG 0: 1
1: 0
2: 1
3: 36
4: 492
1107844047_1107844054 10 Left 1107844047 13:44492648-44492670 CCAAACAAAAAAAAATCACTCTA 0: 1
1: 1
2: 7
3: 219
4: 2195
Right 1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG 0: 1
1: 0
2: 1
3: 36
4: 492
1107844045_1107844054 14 Left 1107844045 13:44492644-44492666 CCCTCCAAACAAAAAAAAATCAC 0: 1
1: 0
2: 26
3: 322
4: 3239
Right 1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG 0: 1
1: 0
2: 1
3: 36
4: 492
1107844044_1107844054 15 Left 1107844044 13:44492643-44492665 CCCCTCCAAACAAAAAAAAATCA 0: 1
1: 1
2: 36
3: 575
4: 6384
Right 1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG 0: 1
1: 0
2: 1
3: 36
4: 492
1107844046_1107844054 13 Left 1107844046 13:44492645-44492667 CCTCCAAACAAAAAAAAATCACT 0: 1
1: 1
2: 15
3: 298
4: 2097
Right 1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG 0: 1
1: 0
2: 1
3: 36
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107844054 Original CRISPR CTGGAGGAATGGTGGAGGAT GGG Intronic
900411821 1:2516023-2516045 CTATAGGGATGGTGGAGGAGGGG - Intronic
900993234 1:6107374-6107396 ATGGAGGGATGATGGAGGAATGG + Intronic
900993431 1:6108139-6108161 ATGGAGGAATGATGGAGGGGTGG + Intronic
900993438 1:6108166-6108188 ATGGAGGGATGATGGAGGGTTGG + Intronic
901006671 1:6175047-6175069 GTGGATGAATGGTGGATGAATGG + Intronic
901229979 1:7636292-7636314 CTTGGGGTATGTTGGAGGATGGG + Intronic
901745406 1:11369808-11369830 CTGGAGGGCGGGTGGAGGAGCGG + Intergenic
901819339 1:11816696-11816718 CTGGAGGGATGGTGGGCCATAGG + Intronic
902409509 1:16204920-16204942 CTAGAGGGATGGAGAAGGATGGG + Intronic
903670247 1:25031171-25031193 CTGGAGGGATGGAGGATGAAGGG + Intergenic
904042613 1:27593221-27593243 CTGGAGGAGTGGAGGGGGAGGGG - Intronic
904327066 1:29733587-29733609 ATGGAGAAAGGGTGGAGGCTTGG - Intergenic
904728083 1:32565424-32565446 CTGGAGGATTGCTTGAGGCTGGG + Intronic
905767224 1:40611221-40611243 CAGGAGGATTGCTTGAGGATAGG - Intergenic
906088258 1:43154958-43154980 CTTGGAGAGTGGTGGAGGATGGG + Intronic
906896394 1:49778113-49778135 GTGGAGGATGGATGGAGGATGGG - Intronic
907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG + Intronic
907550813 1:55303231-55303253 CTGAAGGAATGGGGAAGGAGTGG + Intergenic
907941592 1:59093514-59093536 CTAGAGAATGGGTGGAGGATGGG + Intergenic
908550405 1:65203098-65203120 CAGGAGGATTGCTTGAGGATAGG - Intronic
908645670 1:66275401-66275423 CTGCAGGAAGGGAAGAGGATTGG + Intronic
908801610 1:67886173-67886195 CTGGTTGAATGGAGGAGGAAGGG + Intergenic
909488000 1:76195756-76195778 CTGGAGGAATGTTGGGGAGTAGG - Intronic
910340809 1:86184802-86184824 TTGCAGGAATGGTGGGGGATGGG - Intergenic
911317744 1:96375810-96375832 TTGGAGGAATTATGGTGGATGGG + Intergenic
911768193 1:101704627-101704649 TCTGAGGAATGGTGGAGGAGAGG + Intergenic
912741157 1:112198891-112198913 TGGGAGGCAGGGTGGAGGATGGG - Intergenic
913328751 1:117650265-117650287 CTGGAGGAGTGGTAGGGGAGAGG - Intergenic
915019828 1:152768809-152768831 CTGGAGAAAAGGGGGATGATTGG + Intronic
915105566 1:153533362-153533384 CTGGAAGAAAGGGGGAGGAAAGG + Intergenic
915141536 1:153771398-153771420 CTGGAGGAAGGGGGCAGGAGAGG - Intronic
915573663 1:156760614-156760636 CTGGATGAGTGTTGGGGGATGGG + Intronic
916079535 1:161223741-161223763 TTGGAGAAATGGGGGAGGAGAGG + Intergenic
917149891 1:171932043-171932065 ATGGAGGGAGGGTGGGGGATGGG - Intronic
917470385 1:175321519-175321541 CTTGAGGAATGGGAGAGGAAAGG + Exonic
918128201 1:181602931-181602953 CTGGGGGATAGGTGGGGGATCGG + Intronic
919777994 1:201206549-201206571 CTGGAGGAAAGCAGGAGGCTGGG + Exonic
920074373 1:203325839-203325861 CAGCGGGGATGGTGGAGGATGGG + Intergenic
920323650 1:205144125-205144147 CAGGAGAAATGGTGGAGCCTGGG - Exonic
921015223 1:211183605-211183627 GTGGAGAACTGGTTGAGGATTGG - Intergenic
921295263 1:213695392-213695414 CTGGAGGAGTGGTGGAGAGGTGG + Intergenic
921315818 1:213889120-213889142 CTGGAGGTATTGTGGAGAAGCGG + Intergenic
921809751 1:219499111-219499133 ATGGAGGACTGGTGGAGGACTGG + Intergenic
922794411 1:228333040-228333062 CTGGAGGAAGGCTCCAGGATTGG - Intronic
923131936 1:231083026-231083048 CTGGAGGATTGCTTGAGGTTAGG - Intergenic
923343462 1:233027266-233027288 GTGGTGGAATGGTGGGGGAGGGG + Intronic
924577008 1:245289978-245290000 CTGGAGGAAGGATGGAGGGTAGG - Intronic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064625207 10:17254386-17254408 CTGGACTGATGGTGGAGGATGGG - Intergenic
1064966536 10:21020467-21020489 GTGCAGGAACGGTGGAGGTTAGG - Intronic
1066055794 10:31678917-31678939 CTGGAGGAATGGGGAAAGAAGGG - Intergenic
1067188682 10:44051829-44051851 CTGGAGAAATGGGGGAGAGTGGG + Intergenic
1067229632 10:44397364-44397386 GTGGAGGAATGGGCGGGGATGGG + Intergenic
1067714458 10:48678752-48678774 TTGGAGGAAGGAGGGAGGATTGG - Intergenic
1067726545 10:48775056-48775078 CTGCAGACATGGAGGAGGATGGG + Intronic
1069347837 10:67490581-67490603 GTGGAGGGATGGTGGGAGATGGG + Intronic
1069396951 10:68000083-68000105 CGGGAGGATTGCTTGAGGATAGG - Intronic
1070344266 10:75526290-75526312 CAGGAGGATTGCTGGAGGCTAGG - Intronic
1070616265 10:77971625-77971647 CATGAGGAATGGTGGAGGGGTGG + Intronic
1071746906 10:88431029-88431051 CTGGAAGAATTGTGTAGGATTGG + Intronic
1072153614 10:92703853-92703875 CTAAAGGAATGGAGGAGGAATGG - Intergenic
1072866003 10:99062404-99062426 CTGGAAGAATGTTGGAAGAATGG - Intronic
1073463413 10:103679533-103679555 ATGGAGGAAGGGTGGGGGAGAGG + Intronic
1073485852 10:103818799-103818821 CTGGAGAAGGGGTGGAGGGTGGG - Intronic
1074169963 10:110922309-110922331 CTGTATGAATTATGGAGGATGGG + Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1074542828 10:114379544-114379566 CTGGAGGAATGGTAGAGACAGGG + Intronic
1075929603 10:126284613-126284635 CAGGAGGATTGCTTGAGGATAGG - Intronic
1075936113 10:126342904-126342926 CTGGAGGGAGGGTGGAGGGGTGG + Intronic
1076126478 10:127978148-127978170 GTGTAGGAATGGTGTAGGAAAGG - Intronic
1076298701 10:129407274-129407296 CTGGAGGAGAGGTGGAAGGTTGG - Intergenic
1076578053 10:131483943-131483965 GTGGATGAATGGTGGATGAATGG + Intergenic
1076771674 10:132669471-132669493 CTGGGGGTGTGGTGGAGGAGTGG + Intronic
1077467462 11:2740210-2740232 CAGGAGGGAGGGTGGGGGATGGG + Intronic
1077597784 11:3548902-3548924 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
1077677324 11:4206690-4206712 CTGGAGGACTGCTTGAGGACAGG - Intergenic
1078525851 11:12100720-12100742 CAGGAGGGATGGGGGAGGAACGG + Intronic
1079233257 11:18668334-18668356 AGTGAGGAATGGTGGAGGGTGGG + Intergenic
1081688720 11:45060483-45060505 CTGGAGGAAGGATGGAGCAGTGG + Intergenic
1081743556 11:45457550-45457572 ATGGAAGACTGGAGGAGGATAGG - Intergenic
1081962260 11:47147042-47147064 CAGGAAGAAAGGTAGAGGATAGG + Intronic
1082175485 11:49053873-49053895 CTGGATTAAAGGTGGAGAATTGG + Exonic
1082227182 11:49721971-49721993 CTAGAGGAATGCTGATGGATTGG - Intergenic
1082776279 11:57246879-57246901 CTGGAGGCATCTTTGAGGATGGG + Intergenic
1082783787 11:57305478-57305500 CTGGAGCAGTGGTGGAGGGTGGG - Intronic
1084253872 11:67924810-67924832 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
1084495596 11:69501388-69501410 CTGGAGGATTGGTGAATGAAGGG + Intergenic
1084596277 11:70118807-70118829 AGGGATGAATGGTGGATGATGGG + Intronic
1085451621 11:76637519-76637541 CTGGAGGCCTGGTGCAGGACAGG - Intergenic
1085511718 11:77091594-77091616 CTGTGGGTATGGTGGAGGGTGGG - Intronic
1086020948 11:82228717-82228739 CTGAAGGAAGGGTGGATGAAAGG - Intergenic
1086622238 11:88901121-88901143 CTAGAGGAATGCTGATGGATTGG + Intronic
1088219405 11:107551864-107551886 TTGGAGAAATGGTTGAGGAAAGG - Exonic
1088520957 11:110699789-110699811 CTGGAGGAATAGGGGAGGAATGG - Intronic
1088560055 11:111105571-111105593 CTGGAGAAATGCTGAAGGTTTGG - Intergenic
1089611329 11:119671181-119671203 CTGGAGGGATGGAGGGGGAGGGG - Intronic
1090175064 11:124641398-124641420 CTGGAGGATTTGTGAAGGAAAGG + Intronic
1090548585 11:127792944-127792966 CTGGACGAATGGTGTGGAATGGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091047414 11:132336879-132336901 TTTGAAGAATGGGGGAGGATGGG + Intergenic
1091335932 11:134765795-134765817 ACGGAGGCATGGGGGAGGATGGG + Intergenic
1091693119 12:2610518-2610540 CTGGGAGGGTGGTGGAGGATGGG - Intronic
1091949750 12:4582956-4582978 CAGGAGGAAGGGTAGAGGATGGG + Intronic
1092423942 12:8358199-8358221 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
1094323371 12:29209564-29209586 CTGGAGGAAAACTGGAAGATGGG + Intronic
1095775266 12:46003402-46003424 CTGAAGGAATGGTGCTGCATTGG + Intergenic
1096757548 12:53812786-53812808 CAGGAGGATTGCTGGAGGCTAGG - Intergenic
1096814005 12:54190148-54190170 ATGGGGGAATGGTGGGGGAATGG - Intergenic
1097854670 12:64450242-64450264 CAGGAGGATTGGTAGAGTATGGG - Exonic
1098258828 12:68646672-68646694 GTGGAGGAAGGGTGGAGAATTGG + Intronic
1098347756 12:69524215-69524237 GTGGTGGTATGGTGGGGGATAGG + Intronic
1098375700 12:69811225-69811247 CTTGTGGAAGGGTGGAGGATGGG + Intronic
1099208267 12:79753818-79753840 CTGGAGGAATGCTTGAGCCTGGG - Intergenic
1099920136 12:88947125-88947147 CTGGAGGAATTTTGAAGGAAAGG + Intergenic
1100059643 12:90558618-90558640 CTAGAGGAGTGATGGAGGAAGGG - Intergenic
1100184543 12:92125186-92125208 CTGGAGGAATGCTTGAGCCTGGG + Intronic
1100691809 12:97046409-97046431 ATGGTGGAATGGTGGGAGATGGG - Intergenic
1100951949 12:99860555-99860577 CTGGAGGACACATGGAGGATGGG + Intronic
1103015018 12:117487507-117487529 CTGGAGCAGAGGTGGAGGAAGGG + Intronic
1103518612 12:121523357-121523379 CTGGGGGAATGGTGCAGCAGAGG + Intronic
1104716231 12:131018199-131018221 CTGGAGGAGTGGGAGAGGAGGGG - Intronic
1104942638 12:132402122-132402144 GTGGATGGATGGTGGATGATGGG - Intergenic
1105470955 13:20694307-20694329 CTGGGGTAATGCTGGAGGCTAGG + Intergenic
1105886875 13:24649872-24649894 AGGGAGGAAGGGTGGAGGAGAGG - Intergenic
1105911227 13:24869858-24869880 CAGGAGGAATGGTTGAGCCTGGG - Intronic
1106989217 13:35396844-35396866 CTGGAGGAGTGGTAAAGGACAGG - Intronic
1107844054 13:44492681-44492703 CTGGAGGAATGGTGGAGGATGGG + Intronic
1107867594 13:44717904-44717926 TTGGAAGAATGGGGAAGGATAGG - Intergenic
1108318701 13:49264628-49264650 CAGGAGGATTGGTAGAGTATGGG + Intronic
1109229822 13:59743214-59743236 CTGGAGGAAGGGAGAATGATTGG + Intronic
1109726041 13:66343166-66343188 CTGAAAGAATACTGGAGGATAGG + Intronic
1109827709 13:67744182-67744204 CTGGAGGATTGCTTGAGGACAGG - Intergenic
1110129872 13:71994105-71994127 CTGGAGGAAGGTTGGTGGAAGGG - Intergenic
1110832306 13:80045434-80045456 CTGGAGGAATGGAGGATGATGGG - Intergenic
1111637182 13:90920201-90920223 CTGGAGGATTGCTTGAGCATGGG + Intergenic
1113356779 13:109588641-109588663 CTCGGGGAAAGGTGGAGGAGGGG - Intergenic
1113585507 13:111461709-111461731 CTTGAGCAATAGTGGAGGAGAGG + Intergenic
1113914079 13:113860734-113860756 CTGGAGGAATGTCGGGGGAGGGG + Intronic
1114554066 14:23551459-23551481 CTGGAGGGAGGGAGGAGGAGGGG - Exonic
1114634297 14:24178671-24178693 CTGTAAGAATGGTGGGGGTTGGG + Exonic
1115463394 14:33686731-33686753 CTGGAGGAAGGGTTAAGTATGGG - Intronic
1116799579 14:49429131-49429153 CTAGAAGCATGGTGGGGGATGGG - Intergenic
1116863408 14:50012480-50012502 CAGGAGGACTGGTTGAGGCTAGG - Intergenic
1117361473 14:54979381-54979403 CGGGAGGAATGCTGGAGGCCAGG - Intronic
1118818333 14:69328247-69328269 CTGGAGTGATGGTGGTTGATGGG + Intronic
1119056730 14:71429735-71429757 GTGGAGAAATGGTACAGGATAGG + Intronic
1121412349 14:93756764-93756786 ATGGAGGATTGGGGGAGGAGAGG - Intronic
1124347203 15:28930830-28930852 CGAGGGGCATGGTGGAGGATAGG - Intronic
1125478270 15:40062419-40062441 ATGGAGGAGTGGTGGTGGAGAGG + Intergenic
1125502506 15:40248339-40248361 CTGGAGGAGAGGGGGAGGAAGGG + Intronic
1126352529 15:47759375-47759397 CTGGGGGAAGGGAAGAGGATTGG + Intronic
1126750861 15:51875562-51875584 ATGGAGAAATGCTGGAGGAAAGG - Intronic
1127631519 15:60832267-60832289 CTGGAGGGGTGGTGTGGGATAGG - Intronic
1128525002 15:68406348-68406370 CTGGAGGAGAGGAGGAGGAGAGG - Intronic
1129052116 15:72790320-72790342 GTCTAGGAATGGTAGAGGATGGG - Intergenic
1129391162 15:75221671-75221693 CTGGAAGGATGGTGGATGAGGGG - Intergenic
1129473149 15:75766208-75766230 CTGGAAGGATGGTGGATGAGGGG + Intergenic
1129523205 15:76198578-76198600 CTGGAGTAGGGGTGGAGGCTGGG + Intronic
1129536296 15:76315981-76316003 CTGGAGGAATGGTGCCATATTGG + Intergenic
1129669367 15:77598611-77598633 CTGGAGGAAGGGTGCAGGTGTGG + Intergenic
1129795791 15:78374998-78375020 CTGGCTGAAGTGTGGAGGATGGG + Intergenic
1131441134 15:92460651-92460673 CAGGAGGAATGGTGCTGGCTCGG - Intronic
1132352151 15:101146542-101146564 CTGGAGGAGTGAGGGAGGTTAGG + Intergenic
1132585072 16:702599-702621 CCGGAGGGCTGATGGAGGATTGG + Intronic
1133366723 16:5216147-5216169 CAGGAGGAATGTGGGAGGGTTGG + Intergenic
1133606600 16:7393774-7393796 CTGGAGTAAAGGTGGAGGTAAGG - Intronic
1134121729 16:11588639-11588661 ATGGAGGAATGGCAGAGGTTGGG - Intronic
1134614777 16:15642895-15642917 CTGGTGGGATGGTGGTGGAGAGG - Intronic
1136246311 16:28978205-28978227 CTGGAAGAAAAGGGGAGGATGGG - Intronic
1137626246 16:49910571-49910593 CTGGAGTTCTGGTGGAGGAAGGG - Intergenic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1140174186 16:72639566-72639588 CAGGAGGATTGCTGGAGAATAGG + Intergenic
1140388186 16:74561085-74561107 CTGGAGGGATGGGGCAGGATCGG + Intronic
1141265800 16:82495823-82495845 ATGGAGAAAGGGTGGAGGAAGGG + Intergenic
1141382188 16:83586354-83586376 CTGGAGGAGGGGCGGAGGAAAGG + Intronic
1141885387 16:86888281-86888303 CTGGAGGATTGGGGCAGGAAAGG - Intergenic
1142261686 16:89045445-89045467 CTGGAAGAATGGGGTAGGACAGG - Intergenic
1142666765 17:1467801-1467823 GGGGAGGAGTGGTGGGGGATGGG - Intronic
1142851768 17:2707880-2707902 CTGGTGGAAGGGAGGGGGATGGG + Intronic
1143095234 17:4475338-4475360 CTGGAGGGATGGTGGGGCCTGGG + Intronic
1144244828 17:13352564-13352586 CTGCGGGAATGTTGGAGAATGGG - Intergenic
1144356936 17:14455187-14455209 CTGGGTGAATGGGGTAGGATGGG + Intergenic
1145279140 17:21455637-21455659 CTGGAGGGATGGAGCAAGATTGG + Intergenic
1145398719 17:22514810-22514832 CTGGAGGGATGGAGCAAGATTGG - Intergenic
1145937494 17:28723492-28723514 CCGGAGGACTGGAGGAGGAAGGG + Intronic
1146367009 17:32236937-32236959 CTGGAGAAATGGTTGATGTTGGG - Intronic
1146470012 17:33116626-33116648 CTCCAGGAATGGTGGGGGGTGGG + Intronic
1146643792 17:34562983-34563005 CTGGGGCCAGGGTGGAGGATAGG - Intergenic
1146736284 17:35242030-35242052 CTGGAAGAAGGGTAGAGGAAAGG + Intergenic
1148197327 17:45723518-45723540 ATGGTGGAATGGTGGAAGAAGGG + Intergenic
1148582199 17:48751988-48752010 CTGAAGGAAGGGTGGGGGCTGGG + Intergenic
1148838597 17:50479802-50479824 TTGGAGGAGTGGTGGGGGATAGG + Intronic
1148890416 17:50803103-50803125 CAGGAGGATTGCTTGAGGATGGG - Intergenic
1150449681 17:65256453-65256475 CTGGAGGCATTGTGCAGAATAGG - Intergenic
1151311975 17:73298742-73298764 CTGGAGGGATGGGGTAGGAGGGG - Intronic
1151929289 17:77221317-77221339 CTGGAGGATTGCTGGAGCTTAGG - Intergenic
1152147003 17:78574408-78574430 CTGGAGGATTGGTTGAGCTTAGG + Intronic
1152202707 17:78956384-78956406 CCTGAGGGACGGTGGAGGATGGG + Intergenic
1153056364 18:950028-950050 CTGGGGGAGTGGTGGAGGGCGGG + Intergenic
1153059553 18:981177-981199 ATGGACTAATGGTGGAGTATTGG - Intergenic
1154177515 18:12094626-12094648 GTGGAGGACTGGTGGGGGGTGGG + Intronic
1155095253 18:22549300-22549322 CTGGAGGGAGTGTGGAGAATAGG - Intergenic
1155297004 18:24394089-24394111 CAGGAGAAATGATGGAGAATTGG + Intronic
1156466933 18:37353642-37353664 CTGGGGGAAAGGTGGGGGACTGG + Intronic
1156471613 18:37380594-37380616 ATGGATGAATGGTGGATGAATGG - Intronic
1156654727 18:39271801-39271823 CTGGAGCAGAGGTGGAGGATCGG + Intergenic
1157420979 18:47547225-47547247 CTGGAGGTGTGGTGAAGAATGGG + Intergenic
1157999216 18:52596709-52596731 TAGGAGAAATGGTAGAGGATTGG - Intronic
1158073856 18:53505798-53505820 CAGAAGGAATGGTGAAGGAAAGG + Intronic
1158089961 18:53699298-53699320 CTGGATGAATGGTAGAAGAGAGG - Intergenic
1160780515 19:875885-875907 CTGGAGGATTCCTGGAGGCTGGG + Intronic
1160971398 19:1769323-1769345 CAGGAGTGATGGTGGAGGAGAGG + Intronic
1161436284 19:4265492-4265514 CGGGAGGACTGCTTGAGGATAGG - Intronic
1161662588 19:5556163-5556185 CTAGAGGATTGCTGGAGGCTAGG - Intergenic
1162106114 19:8370910-8370932 CTGGAGGACTCGAGGAGGGTGGG - Intronic
1162395568 19:10416613-10416635 CGGGAGGAAGGGTGGGGGCTGGG + Intronic
1162401210 19:10447752-10447774 CTGGAGGAAGGGCAGAGGGTGGG - Intronic
1163007029 19:14403443-14403465 CTGGAGGAATGGTTGAGTTCAGG - Intronic
1163061222 19:14763727-14763749 GAGGAGGAATGGAGGAGGAGAGG - Intronic
1163276919 19:16290699-16290721 CTTGGGGAATGGTGGAGAATTGG - Intergenic
1163410881 19:17153756-17153778 CTGGAGGATTGGAGGTGGGTGGG - Intronic
1164123012 19:22285203-22285225 CTGGAAGAAAGGTGGAAAATGGG + Intergenic
1164213185 19:23118020-23118042 CTGGAGGAATGGGGGTTGAGGGG - Intronic
1164316007 19:24088486-24088508 CTGGAGGAATAGGGGATGAGGGG - Intronic
1164727135 19:30473595-30473617 CTGGAGGCATGTGTGAGGATGGG - Intronic
1165097526 19:33417706-33417728 CTGGAGGGAGGCTGGAGAATGGG + Intronic
1165752066 19:38266211-38266233 GGGGAGGACTGGAGGAGGATGGG + Intronic
1166099971 19:40566015-40566037 CTGCAGGAATGGCAGAGGCTGGG - Intronic
1166289600 19:41854004-41854026 CTGGAGGAGAGGTGAAGGAGAGG - Intergenic
1166459559 19:42974148-42974170 CTGGAGGGATGTTGGAGACTGGG + Intronic
1166476877 19:43134193-43134215 CTGGAGGAATGATGGAGACTGGG + Intronic
1166929909 19:46296436-46296458 CTGGAGGAATGGGGGCGAAGTGG + Intergenic
1168017067 19:53582102-53582124 CTGGAGGAATGTGGGAGTAGGGG + Intergenic
926157717 2:10466854-10466876 CTGGAGGAATGGGGTAGGGAGGG - Intergenic
926763045 2:16296422-16296444 CTGGAGCAAAGTTAGAGGATGGG - Intergenic
927102700 2:19800178-19800200 CTGGAGGCATGCTGCTGGATGGG - Intergenic
927197701 2:20559550-20559572 GTGGATGAATGGAGGTGGATGGG + Intergenic
927762450 2:25771490-25771512 CTGCTGGAATGGTGGGTGATGGG + Exonic
928154801 2:28867024-28867046 CAGGAGGATTGCTGGAGGCTAGG - Intronic
928205271 2:29279376-29279398 CTGGAGCCATGGGGGAGGGTTGG - Intronic
928205301 2:29279455-29279477 CTGAAGGATGGGTGGAGGGTGGG + Intronic
928287687 2:30007806-30007828 CTGGAGGATTGCTGTAGGCTGGG + Intergenic
928946349 2:36775368-36775390 CTGGAGGACTGTCTGAGGATGGG - Intronic
929656116 2:43733404-43733426 CTGGAGGAGTGGAGGAGAAAGGG - Intronic
930001367 2:46863897-46863919 CTGGGGCCATGGTGGAGGAGGGG - Intergenic
930364167 2:50417946-50417968 CTGAAGGCAAGGTGGAGGAACGG + Intronic
930642616 2:53869580-53869602 CTGAGGGAATAATGGAGGATAGG + Intronic
930670698 2:54147304-54147326 CTTGAGGAATGGTGGTGACTGGG + Intronic
930962484 2:57277725-57277747 ATGCAAGAGTGGTGGAGGATTGG + Intergenic
931271644 2:60708883-60708905 CTGGAGCAGTGGCTGAGGATGGG - Intergenic
932237801 2:70135080-70135102 CTGGAGGATTGGTTGAGCCTAGG - Intergenic
932237822 2:70135246-70135268 CTGGAGGATTGGTTGAGCCTAGG - Intergenic
934621738 2:95814390-95814412 AGGGAGGAATGATGGAGGGTAGG - Intergenic
934811709 2:97284423-97284445 AGGGAGGAATGATGGAGGGTAGG + Intergenic
934825982 2:97423517-97423539 AGGGAGGAATGATGGAGGGTAGG - Intergenic
934883091 2:98000349-98000371 CTGGAGGAATCCAGGAGGAATGG - Intergenic
935735462 2:106103437-106103459 CTGGGTGAGTGGAGGAGGATGGG + Intronic
936476823 2:112846822-112846844 CTTTGGGGATGGTGGAGGATGGG - Intergenic
936905504 2:117531611-117531633 CTTCAGGGATGGGGGAGGATGGG + Intergenic
937468353 2:122154453-122154475 CTGGAGGAGTGGTCCAGGACAGG - Intergenic
937848022 2:126602667-126602689 CTGGAGGAAGTGTGAAGCATGGG - Intergenic
938616399 2:133003647-133003669 CTGGATAAATGTTGGAGGACTGG + Intronic
941083763 2:161092413-161092435 CTGGAGGAGTGGTGGTGGAGTGG + Intergenic
941438117 2:165497149-165497171 CTAGAGTAATGGTGGTGGAGTGG - Intronic
942167116 2:173252829-173252851 CTGGAGGTATTGTGTATGATTGG - Intronic
942285751 2:174414055-174414077 CTGGAGGAAAGGTGAAAGTTGGG - Intronic
945707755 2:213257020-213257042 CTGGAGAAAATGTGGAGTATAGG + Intergenic
946354166 2:219174547-219174569 CTGGAGGAATAGAGGAGGCGAGG + Intronic
948377485 2:237531025-237531047 CTGCAGGGAGGGTGGAGTATCGG + Intronic
948462621 2:238137704-238137726 CTGGAGGAACTGGGGAGTATTGG - Intergenic
1169191723 20:3662342-3662364 CTGGAGAACTTGTGGAGGCTGGG - Intronic
1170317688 20:15060563-15060585 CTGGGGGAAAGTTGGAAGATGGG - Intronic
1170361171 20:15548072-15548094 ATGGAGGAAGGGAGGGGGATAGG - Intronic
1170605038 20:17869597-17869619 AAGGAGGGATGGTGCAGGATGGG - Intergenic
1171128458 20:22625737-22625759 CAGGAGGATTGCTTGAGGATAGG - Intergenic
1171150806 20:22825005-22825027 CAGGTGTAATGGTGGAGGTTTGG + Intergenic
1172214970 20:33228980-33229002 CTGGAGGATTGCTTGAGGCTAGG + Intergenic
1172390109 20:34560104-34560126 CTGGTGGGATGGGGGAGGGTGGG + Exonic
1172423732 20:34840067-34840089 CTGGAGGATTGCTGGAGCCTAGG - Intergenic
1172767682 20:37359446-37359468 CTGGTGGGCTCGTGGAGGATGGG + Intronic
1173006143 20:39141219-39141241 CTGGTGGCATGGAGGAGGAAGGG - Intergenic
1173021340 20:39270028-39270050 ATGGATGAATGGGGAAGGATGGG - Intergenic
1175390128 20:58621872-58621894 CTGGTGGACTGGGGGAAGATGGG - Intergenic
1177255106 21:18651837-18651859 ATGGAGGAATGCTGGAGGTATGG - Intergenic
1178183832 21:30196413-30196435 CTTGAGAAATAGTAGAGGATTGG + Intergenic
1178683734 21:34695221-34695243 CTGGAGTAAAGACGGAGGATGGG - Intronic
1178690913 21:34748893-34748915 CTGTCTGAATGGTGGATGATGGG - Intergenic
1179189254 21:39108935-39108957 GTGGAGGAAGGGAGGAGGAAGGG - Intergenic
1180167984 21:46040028-46040050 CTGGAGGGAGGGTGGAGGGCGGG - Intergenic
1182239469 22:28903580-28903602 CTGGAGGAGGGGTTCAGGATGGG - Intronic
1182504735 22:30773604-30773626 TTGGAGGAATGGGGGAGGGAAGG + Intronic
1183012577 22:34959175-34959197 CTGGAGTAATAGAGGAGGCTGGG - Intergenic
1183269156 22:36849947-36849969 CTGTAGGGATGGAGGAGGAGAGG + Intergenic
1183717720 22:39543635-39543657 CAGGTGGAGTGGTGGAGGAGGGG + Intergenic
1183951429 22:41355122-41355144 CTGGATGAAGAGTGGAGGAAGGG + Intronic
1184413625 22:44339723-44339745 CTCGAGGGACAGTGGAGGATGGG - Intergenic
1185104340 22:48858841-48858863 TTGGATGGATGATGGAGGATGGG - Intergenic
1185104350 22:48858876-48858898 ATGGATGAATGATGGAGGGTGGG - Intergenic
1185395297 22:50583575-50583597 CTGGAGGAGACGAGGAGGATAGG - Intronic
949344301 3:3062370-3062392 CTGGAGGAATGGGATAGGATAGG + Intergenic
949382233 3:3459366-3459388 TTGGAGGAATGGTGGTGGAAAGG + Intergenic
950825033 3:15809605-15809627 ATGAAAGAATGGGGGAGGATGGG + Intronic
950888340 3:16380459-16380481 CTGGAGGAATTGGAGAGGCTTGG + Intronic
950938460 3:16867602-16867624 CTAGAGGAATGGTGGATGCATGG + Intronic
951878924 3:27461542-27461564 CTGGAGGATGGCTTGAGGATAGG + Intronic
952381133 3:32806369-32806391 CAGGAGGATTGGTGGAGCCTGGG - Intergenic
952883493 3:37999251-37999273 TTGGAGGGATGGTTGAGGAGTGG + Intronic
952937874 3:38414324-38414346 TTGGAGGCATGGTGGATGAAAGG + Exonic
953060008 3:39419405-39419427 TTGGAGGAAAGGAGGAAGATAGG - Intergenic
953285241 3:41600180-41600202 AAGGAGGAGTGGTGGTGGATAGG - Intronic
953339839 3:42124043-42124065 TGGGAGGAATGCTTGAGGATCGG + Intronic
953395151 3:42563287-42563309 CTGGGGGCAGGGTGGAGGAAGGG - Intronic
953574362 3:44101202-44101224 CTGGGAGAATGGTGGAGGCAGGG + Intergenic
954553606 3:51501998-51502020 CTGAAGGAGTGCTGGAGGAATGG - Intergenic
954622917 3:52005944-52005966 CTGGAGGAATGGGCGAGAAAGGG - Intergenic
954636650 3:52074469-52074491 CTGGGGGACTGATGGGGGATGGG + Intergenic
955838179 3:63081280-63081302 TTGGAGGAATGTGGGAGAATTGG + Intergenic
957067948 3:75541285-75541307 GTGGAGGAAAGGTAGGGGATAGG + Intergenic
958474612 3:94564880-94564902 CAGAAGGAATAGTGTAGGATAGG + Intergenic
958942480 3:100331480-100331502 CTGGAGGAATGCTGATGGAAAGG + Intergenic
958944702 3:100350190-100350212 CTGGTTGCATGGTGGAAGATGGG + Intronic
958972657 3:100629635-100629657 CTGCAGGAATGGTGGAACCTGGG + Exonic
959667983 3:108942836-108942858 CTGGAGGCATGGAGGAGGGAAGG - Intronic
960031901 3:113062533-113062555 CTGGAGGAATGGCTGATTATAGG - Intergenic
960846551 3:122009156-122009178 CTGGAGGATTGCTTGAGGTTAGG - Intronic
960898515 3:122530833-122530855 CAGGAGGATTGGTGGAGGTCAGG + Intronic
961285213 3:125796698-125796720 GTGGAGGAAAGGTAGGGGATAGG - Intergenic
961359283 3:126357092-126357114 CTGGAGGAATGTCGGAGGAGCGG - Intronic
961411913 3:126728344-126728366 CAGGAGGAATGGTGGTGGGTGGG + Intronic
962268539 3:133961036-133961058 CTGGAGGACTTGTGCATGATGGG + Intronic
964653509 3:159040192-159040214 CTGGAGGAATGCTGGAAGAGAGG - Intronic
965061051 3:163786440-163786462 CTGGGGCCACGGTGGAGGATTGG + Intergenic
965443722 3:168748609-168748631 CAGGAGGAATGGTGGAGTACTGG - Intergenic
966495923 3:180580506-180580528 CTGGAGGAATGGGAGAGGCTAGG + Intergenic
966496062 3:180582066-180582088 ATGGAGGGATGGTGGAACATAGG + Intergenic
966746459 3:183281703-183281725 CTGGAGGAAAGGATGAGGAGAGG + Intronic
967194628 3:187015744-187015766 TGGGAGGATTGGTGGAGGCTGGG + Intronic
967237660 3:187402721-187402743 CTGGAGTAATGATGGTGCATAGG - Intergenic
967957024 3:194885166-194885188 ATGGAGGAAGAGTGGAGGAAAGG + Intergenic
968682136 4:1928710-1928732 CTGGAGTCATGGTGGGTGATGGG + Intronic
969400411 4:6951713-6951735 GGGGTGGAATGGTGGAGGAGAGG + Intronic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
969741566 4:9031876-9031898 GTGGAGGAAAGGTAGGGGATAGG - Intergenic
969800935 4:9564779-9564801 GTGGAGGAAAGGTAGGGGATAGG - Intergenic
969982738 4:11175301-11175323 CTGGGGCAATGGTGGAAGACTGG - Intergenic
970212732 4:13728024-13728046 CTGGAAGATTAATGGAGGATGGG - Intergenic
970597731 4:17615284-17615306 AAGGAGGAATGCTGGAGGTTAGG + Intronic
970860389 4:20696102-20696124 CTGGGGGGAGGATGGAGGATGGG - Intergenic
970950511 4:21750081-21750103 CTGGAGAGAGGGAGGAGGATGGG - Intronic
971175437 4:24277945-24277967 CTGGAGGAATGCTTGAGGCCAGG + Intergenic
972606519 4:40618980-40619002 CTGGAGGAAGGACTGAGGATGGG - Intronic
975830655 4:78364857-78364879 CTGAAGGAATTGTGGAGTAGTGG + Intronic
975912173 4:79279875-79279897 CTGGGGAAATGGGAGAGGATGGG + Intronic
976453529 4:85219437-85219459 GTGCAAGAGTGGTGGAGGATTGG + Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977267012 4:94867203-94867225 CTGGAGGCATGCTTGAGAATGGG - Intronic
977570820 4:98627541-98627563 ATGGAGGAATGGGGGAGTAAGGG - Intronic
981718901 4:147779237-147779259 CTGGAGCAGAGGTGGAGGGTAGG + Intronic
981978401 4:150760424-150760446 CTGGCGGAATTGTTTAGGATAGG - Intronic
982023048 4:151223523-151223545 CTGGAGGAATGGCGGATTCTGGG - Intronic
983689027 4:170445729-170445751 CTGGTGGAATGGCGGAGGCCTGG + Intergenic
984258856 4:177419967-177419989 TTGGTGGAATGATGGAGAATAGG - Intergenic
984938671 4:184912394-184912416 CTGGATGAATGGGAGAGAATTGG - Intergenic
984943578 4:184954305-184954327 ATGGAGGGATGGTTGAGGTTGGG + Intergenic
984959474 4:185081592-185081614 TGGGAGGCAGGGTGGAGGATGGG - Intergenic
987225093 5:15831742-15831764 CTGGAGGGATAGTGGAGGGGAGG + Intronic
987864697 5:23524203-23524225 CCGGAGGAGTGGTGGGGGAGTGG + Intronic
987952238 5:24689952-24689974 CTGGAAGTATAGTGGGGGATTGG + Intergenic
988058715 5:26137199-26137221 CTAGAGGAATGAGGGAGGTTGGG + Intergenic
988457365 5:31398286-31398308 TTGGAGGAATGGAAGAGAATTGG - Intergenic
988673553 5:33408111-33408133 CTTGAGGAATGAGGGAGAATTGG + Intergenic
988806497 5:34745657-34745679 CTGGAGGCATCGGGTAGGATGGG - Intronic
988827289 5:34950907-34950929 CTAGAGGAACCGAGGAGGATGGG - Intronic
989330433 5:40251944-40251966 CTGGAGGGTGGGAGGAGGATGGG - Intergenic
989722789 5:44549829-44549851 AATGAGGAATGGTGGAGGCTTGG - Intergenic
990309212 5:54521606-54521628 CTGGAGGATTGCTTGAGGCTAGG + Intronic
990543955 5:56803710-56803732 CTGGAGAAATGGGAGAGGGTAGG - Intergenic
992170291 5:74094885-74094907 CAGGAGCCATGGTGGGGGATGGG - Intergenic
992699663 5:79329408-79329430 CTGGAGGAATTGTGAAAGACGGG - Intergenic
992941697 5:81768868-81768890 CAGGAGGAATGCTTGAGGCTAGG - Intergenic
993143124 5:84059171-84059193 CAGGAGGATTGGTGGAGGCTAGG + Intronic
993712051 5:91234946-91234968 CTTGAGGGATGGTGGAAGAATGG + Intergenic
993809987 5:92464167-92464189 CTAGAGGAAAGGAGGAGGATGGG + Intergenic
996118786 5:119648110-119648132 CTGGAGCTAAGGTGGAGGGTAGG + Intergenic
997411783 5:133696365-133696387 CTGCAGGAAGGCTGGTGGATGGG - Intergenic
999283151 5:150378147-150378169 TTTGAGGAATGCTGGGGGATGGG + Intronic
1000567473 5:162867668-162867690 CAGGAGGAATGGTGGTGGGGAGG - Intergenic
1000890185 5:166792584-166792606 CTGGAGGATGGCTTGAGGATGGG + Intergenic
1000920267 5:167129470-167129492 CTGGAGTAATCATGGAGGAAGGG + Intergenic
1001430675 5:171659263-171659285 CAGGAGGGATGGAGGAGGTTGGG + Intergenic
1001557334 5:172645670-172645692 CTGGTGGAAGGGAGGAAGATGGG - Intronic
1001836708 5:174838506-174838528 CGGGAAGAGTGGTGTAGGATGGG + Intergenic
1002057073 5:176604332-176604354 CATGAGGCATGGTGGAGGAGGGG + Intronic
1003267166 6:4575997-4576019 GTGGAGGGATGGCGGAGGAATGG - Intergenic
1003487952 6:6595817-6595839 GTGGTGGAATGGTTGGGGATGGG - Intronic
1004176768 6:13347037-13347059 CTGGAGGAGAGGTGTAGGAAAGG - Intergenic
1004201136 6:13549094-13549116 CTGGTGGGATGTTGGAGGAGGGG + Intergenic
1004500530 6:16206042-16206064 CAGGAGGATTGCTGGAGGGTGGG - Intergenic
1005070098 6:21854170-21854192 CTGGAGCAGGGGTGGAGGAATGG + Intergenic
1005779277 6:29171619-29171641 CCGGAGGAATGCTGAAAGATGGG + Intergenic
1005796665 6:29370075-29370097 CTTCAGGGATGGGGGAGGATGGG - Intronic
1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG + Intergenic
1007848008 6:44776695-44776717 GTGGAGAAAGGGTGGAGGATGGG - Intergenic
1010087849 6:71941617-71941639 CTGGAGATATTGTGGAGGAAAGG - Intronic
1010274504 6:73953500-73953522 CAGGGGGAATGGTGGAAGAGAGG - Intergenic
1011383061 6:86763526-86763548 CTGTAGGAATGGTGTGGGACAGG + Intergenic
1013993594 6:116281147-116281169 GGGAAGGAATGGTGGAGAATAGG + Intronic
1014406444 6:121057823-121057845 CTGCAGTAATGGTTGAGGCTGGG - Intergenic
1015239136 6:131004646-131004668 CTGGAGGAGTGGTGGGGGTAAGG - Intronic
1015809482 6:137147120-137147142 CTGGAGGATTGGTTGAGGCCAGG + Intronic
1015887141 6:137929108-137929130 CTGGAGGAGTGGGGTAGGAGAGG - Intergenic
1017215587 6:151902208-151902230 CTTGAGGAATGGAGGAAGTTTGG - Intronic
1018276343 6:162135748-162135770 CTGAAGGAATGGGGGAGGGGAGG + Intronic
1018350985 6:162959144-162959166 CAGGAGGATTGCTTGAGGATAGG - Intronic
1019466026 7:1189492-1189514 CTGGAGGATTGCTTGAGCATGGG + Intergenic
1019954169 7:4399809-4399831 TTGGAGGAATGGTGGAGCCGGGG + Intergenic
1020250229 7:6461682-6461704 CTGGAGGAAGGGAGCAGGATGGG - Exonic
1022317316 7:29257466-29257488 ATGAAGGGATGGTGGAGGAGAGG - Intronic
1022453436 7:30536879-30536901 TTGGAGGAATGGGAGAGAATTGG + Intronic
1022580497 7:31548603-31548625 CTCCAGGAAGGGTGGAAGATTGG + Intronic
1023346141 7:39273198-39273220 CTGGAGGCAAGGGGGAGGGTAGG - Intronic
1023742830 7:43295627-43295649 GGGGAGGAGTGGTGGAGGAGGGG + Intronic
1023789055 7:43737544-43737566 CTGCAGGAATGTTGGGGGTTGGG - Intergenic
1023827627 7:44020015-44020037 CTGGAGGACTGCTGGAGGCCAGG - Intergenic
1023881560 7:44324289-44324311 CTGAAGGGACGGAGGAGGATGGG + Intronic
1024296497 7:47847287-47847309 ATTGAGGAATGGTAGAGAATTGG + Intronic
1026050349 7:66941328-66941350 CTGGAGCAATGGTGTAGTCTTGG - Intronic
1026676308 7:72431378-72431400 CTGGAGGAATGCCAAAGGATTGG - Intronic
1026892233 7:73989002-73989024 CTGGAGGATTGCTGGAGGCCAGG + Intergenic
1029371204 7:100151929-100151951 CAGGAGGAATGCTGGAGGCCAGG - Intronic
1029738804 7:102479784-102479806 CTGGAGGACTGCTGGAGGCCAGG - Intergenic
1029755929 7:102573440-102573462 CTGGAGGACTGCTGGAGGCCAGG - Intronic
1029773870 7:102672512-102672534 CTGGAGGACTGCTGGAGGCCAGG - Intergenic
1031242248 7:119260933-119260955 CAGGAAGAAAGGTGGAGGAAAGG - Intergenic
1031445658 7:121850415-121850437 ATGGAGGAAGGGTTGAGGAGAGG - Intergenic
1031981603 7:128130526-128130548 CTGGAGTCAGGGTGGAGGTTAGG + Intergenic
1032097667 7:128947570-128947592 CTGGGGGATTGGGGTAGGATTGG + Intronic
1032345511 7:131112751-131112773 GTGGTGGAATGATGGAGGAAGGG + Intronic
1032377045 7:131430833-131430855 CAGGAGGACTGCTTGAGGATTGG + Intronic
1032665259 7:134029746-134029768 CTGGAGGACTGCTTGAGAATAGG - Intronic
1032678791 7:134159819-134159841 CTGCAGGAATGGAAGAGGTTTGG - Intronic
1033538160 7:142331207-142331229 CTGGGGGGATGGAGGAGGCTGGG + Intergenic
1033540572 7:142352420-142352442 GTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033551839 7:142454728-142454750 CTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033554119 7:142473661-142473683 CTGAGGGAATGGAGGAGGCTGGG + Intergenic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1033662447 7:143411579-143411601 CTAGGAGAATGGTGGAGGCTAGG + Intergenic
1033986159 7:147228006-147228028 ATGGAGGAATGGCTAAGGATTGG + Intronic
1035939212 8:3877148-3877170 CTGTAGGAAAGGTAGAGGAAGGG - Intronic
1036109139 8:5878557-5878579 CTGGAGGAAGGGTGAGGGAGTGG - Intergenic
1036246775 8:7124476-7124498 GTGGAGGAAAGGTAGCGGATAGG - Intergenic
1036409309 8:8484057-8484079 CTGGAGGATTGCTTGAGGCTGGG + Intergenic
1036474378 8:9079896-9079918 CTGGAGGACTGCTGGAGCCTAGG - Intronic
1036617528 8:10400183-10400205 CTGGAGGAATTGTGGAGGCCAGG + Intronic
1036778298 8:11628570-11628592 CTGGAGGAATGGAGGAGGCCCGG + Intergenic
1037583083 8:20257464-20257486 TTGGAGGAATGGTGGAAGGAAGG + Intronic
1038100596 8:24369969-24369991 CAGGAAGAAAGGTGGATGATTGG - Intergenic
1038364091 8:26913454-26913476 GTGCAGGAAAGGTGGAGGTTTGG + Intergenic
1038519414 8:28217017-28217039 CTGGAGGAATGGAAGCAGATGGG + Intergenic
1038643784 8:29347857-29347879 CTGGGGAAATGGAGGAGGTTGGG + Intronic
1040973794 8:53167552-53167574 CTGGAGGTGGAGTGGAGGATTGG + Intergenic
1043774316 8:84245754-84245776 CTGAAGGAATGCTGTAGGGTGGG + Intronic
1044753634 8:95439699-95439721 CTGGAGGATTGCTGGAGGGAGGG + Intergenic
1045085096 8:98673611-98673633 CAGGTGGGATGGTGGAGAATGGG + Intronic
1046027527 8:108743802-108743824 GTGGAGGAGAGGGGGAGGATGGG - Intronic
1046079988 8:109360526-109360548 ATGGAGGAAAGGTAGAGGTTGGG - Intergenic
1046097785 8:109580814-109580836 AGTGAGGAGTGGTGGAGGATGGG - Intronic
1046587926 8:116170268-116170290 CTGGAGGATGTGTGGAGGACAGG - Intergenic
1046690985 8:117283964-117283986 CTGGAGGTAAGGAGGAGGAAAGG - Intergenic
1046860892 8:119090236-119090258 CTGGAGAAATGGTGGGGTACGGG + Intronic
1047311976 8:123699591-123699613 CAGGAGAAATGGTCAAGGATGGG + Intronic
1047662306 8:127050632-127050654 CTGGAGGAGTGGGTGAGCATTGG + Intergenic
1047741807 8:127812465-127812487 CTGGAGGATTGCTTGAGGATGGG + Intergenic
1048444578 8:134483868-134483890 CTGGATGAATGGATGACGATGGG - Intronic
1048491516 8:134897991-134898013 CTGAAGGCATGGCAGAGGATAGG - Intergenic
1048767496 8:137860834-137860856 CTGGAGGAAGGGAGGAGAGTTGG + Intergenic
1049120558 8:140733215-140733237 CTGGAGGAAGTGAGGAGGAAGGG + Intronic
1049525999 8:143127310-143127332 TTGGAGGAGTGGTAGGGGATGGG + Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1051231276 9:14958025-14958047 CTTGGGGGATGGTGGAGGATAGG + Intergenic
1051896968 9:21996816-21996838 CTGGAGGAATGGAGTGGGAGCGG + Intronic
1052008568 9:23379885-23379907 CAGGAGGAATGCTTGAGGCTAGG + Intergenic
1052402977 9:28024324-28024346 CCGGAGGATGGGTGGAGGGTGGG + Intronic
1052849960 9:33372045-33372067 CTGGGGGAATGGTTGAGTAAGGG + Intergenic
1054728447 9:68676505-68676527 TGGGAGGAATGGTGCAGGACTGG + Intergenic
1054740957 9:68805254-68805276 TGGGAAGAATGGTGGAGGAGCGG + Intronic
1055646008 9:78362059-78362081 CTGGAGGAATGTAGGAACATGGG - Intergenic
1056352387 9:85763617-85763639 TTGGGAGAATGGAGGAGGATGGG + Intergenic
1056769331 9:89465460-89465482 CTGGGGGAATGGGGATGGATTGG + Intronic
1056770853 9:89477021-89477043 CTGGAGGCATGGAGGAGAGTGGG + Intronic
1057217112 9:93235176-93235198 CTGAAGGGATGGTGGTGCATGGG + Intronic
1057817165 9:98304225-98304247 CTGGAGGGATGGTGGGGGGAAGG + Intronic
1057924535 9:99132415-99132437 CTGCAGGAATTGTGTAGGATTGG + Intronic
1058044523 9:100342035-100342057 CTGGGAGAATGGTAGAAGATGGG - Intronic
1058210001 9:102155388-102155410 CTGGAGGATTGCTTGAGGACAGG + Intergenic
1059506442 9:114803670-114803692 TTGGAGGCAGGGTGGGGGATGGG + Intronic
1060274793 9:122174230-122174252 CCGAAGAAATGGAGGAGGATGGG + Intronic
1060458662 9:123826520-123826542 CTGGAAGTAAGGTGGAGGAAAGG - Intronic
1060692089 9:125671867-125671889 CTGGAGGAATTGTGGGGGAGTGG - Intronic
1060952495 9:127612793-127612815 GTGGAGGAAGGGGGAAGGATGGG - Intronic
1061563360 9:131420827-131420849 CTGGAGGTGTGGTGGGGGTTGGG + Intronic
1061965298 9:134010427-134010449 GTGGGGGAAGGGTGGAGGCTGGG + Intergenic
1062318198 9:135978380-135978402 CAGGGGGGATGGTGGGGGATGGG - Intergenic
1062607068 9:137353182-137353204 CAGGAGGGCTGGTGGAGGCTTGG - Intronic
1203658604 Un_KI270753v1:21385-21407 GTGGAGTAAGGGTGGAGGGTGGG + Intergenic
1185566257 X:1097632-1097654 CTGGAGGAAAGGTGGGTGAGAGG + Intergenic
1185724926 X:2411958-2411980 CTGGAGGAATGGAGAAGGTGAGG + Intronic
1185813056 X:3128517-3128539 CAGGAGGATTGCTGGAGGACAGG - Intergenic
1185923196 X:4116730-4116752 CTGGAGGGAAGGTGGGGGAGGGG + Intergenic
1186186932 X:7029801-7029823 CTGGAGGGATGATGGAGATTGGG + Intergenic
1186320122 X:8415063-8415085 ACGGAGGAATGGTGGAGGAATGG + Intergenic
1187471814 X:19576668-19576690 CTGGAGGACTGCTGGAGGCCAGG - Intronic
1190080014 X:47349138-47349160 CTGAAGGATTGCTTGAGGATAGG - Intergenic
1190325515 X:49204844-49204866 CTGGAGGCAGAGTGGAGGAGGGG - Intergenic
1190464810 X:50715705-50715727 GTGGAGGAAAGGTGGTGGTTAGG + Intronic
1190894038 X:54597914-54597936 CTGGGGGGATGGTGGAGGGGTGG + Intergenic
1191987508 X:66998070-66998092 ATGGAGAAATGGAGGTGGATGGG + Intergenic
1192196617 X:69033017-69033039 CTGGAGGGATGGTGGGGGTGGGG - Intergenic
1192943807 X:75942560-75942582 TTGGGGGAATGGGGGAAGATGGG - Intergenic
1192946377 X:75968471-75968493 CTGGAGTAAGGGTGGGGCATGGG + Intergenic
1193392260 X:80942542-80942564 GTGGGGGGATGGGGGAGGATAGG + Intergenic
1194970104 X:100333418-100333440 TTGGAGGAATGGTGGAAGCCAGG - Intronic
1195120456 X:101745087-101745109 CAGGAGGAAGGGAGGAGGAAAGG + Intergenic
1196647288 X:118131771-118131793 CAGGAGGAATGTTTGAGGCTGGG - Intergenic
1197707793 X:129646786-129646808 CTGGGGGAATGGTGCAGCAGGGG + Exonic
1198270373 X:135051401-135051423 CTGGAGGAGTGGAGGTGGGTTGG + Exonic
1199672978 X:150162028-150162050 CTGGGGGTAGGGTGGAGGTTGGG + Intergenic
1200153792 X:153964608-153964630 TTGGTGGGATGGTGGAGTATGGG - Exonic
1200611759 Y:5333579-5333601 TTGGAGGAATGCTTGGGGATTGG + Intronic
1201617160 Y:15913414-15913436 GTGGAGGAATGGAGGAAGAGGGG - Intergenic