ID: 1107851866

View in Genome Browser
Species Human (GRCh38)
Location 13:44578233-44578255
Sequence TTCTGTCCTCCAGTTAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107851866_1107851873 12 Left 1107851866 13:44578233-44578255 CCATCCTTAACTGGAGGACAGAA 0: 1
1: 0
2: 3
3: 18
4: 213
Right 1107851873 13:44578268-44578290 TGTAATCGACTGACCTCAACAGG 0: 1
1: 0
2: 0
3: 3
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107851866 Original CRISPR TTCTGTCCTCCAGTTAAGGA TGG (reversed) Intergenic
901116243 1:6847229-6847251 TCCTGGCCTCAAGTGAAGGATGG + Intronic
901385806 1:8908322-8908344 TTCTGTCTTCAAAATAAGGAGGG + Intergenic
909001738 1:70225728-70225750 TTCTGTCCTCCAACTAAGAGCGG - Intronic
909017277 1:70393691-70393713 TTCTGTCCTCCGTTTAAAGTGGG - Intergenic
909881427 1:80884199-80884221 TTCTCTCCTCCTTTTAAGGAAGG - Intergenic
910077140 1:83294974-83294996 TTGTGTACACCAGTTAAGGAAGG + Intergenic
910532254 1:88250986-88251008 CTCTGTCCTGGAGTTAAGGTTGG + Intergenic
911304609 1:96217631-96217653 TTCTGTCTTCCTGTTAAAGATGG - Intergenic
911575616 1:99573943-99573965 TTCTGTGCTTGAGTTAAGAAAGG - Intergenic
912197624 1:107417831-107417853 TTGTGTCTTCCAGTTATGGAAGG - Intronic
915589296 1:156861474-156861496 CTCTGTCCTACAGAGAAGGATGG + Intronic
917191314 1:172422224-172422246 TTCTCTCCTCAAGCAAAGGAAGG - Intronic
918124957 1:181575176-181575198 TTCTGTCCTCCAGTGCAGGAGGG - Intronic
919847922 1:201653264-201653286 TTCTGTCCTCCAGGAAAAGGGGG + Intronic
921395653 1:214666453-214666475 TTCTCTTCTGTAGTTAAGGAGGG + Intergenic
921775859 1:219098849-219098871 TTCTGACCTTTGGTTAAGGAAGG + Intergenic
922948740 1:229539875-229539897 TTGTTTCCTCTAGTTAGGGAAGG - Intronic
923093717 1:230758476-230758498 TTCTGTGCTCCAGCTAAGGCTGG + Intronic
1062979801 10:1712639-1712661 CTCTGTCCCCCAGGGAAGGAGGG + Intronic
1063240749 10:4167110-4167132 TTCTGTACTCCAGATAAGATGGG + Intergenic
1065153467 10:22846381-22846403 TTCTGTCATTCAGTCAAGTAAGG + Intergenic
1065778320 10:29143115-29143137 CTCTGTCCTTCTGATAAGGAAGG + Intergenic
1066446792 10:35491163-35491185 CTCTGGCCTCCAGTTAGGCAAGG + Intronic
1066649777 10:37643267-37643289 TTCTTCCTTCCACTTAAGGAGGG - Intergenic
1067032666 10:42888812-42888834 TTCTTTCCTCCACTTAAGGAGGG - Intergenic
1067083928 10:43228326-43228348 TGCTGACCACCAGTGAAGGAGGG - Intronic
1068045054 10:51876044-51876066 TTCTGTTTTCCCTTTAAGGAAGG + Intronic
1068607945 10:59026408-59026430 CTCTGTCCTTGAGATAAGGAAGG + Intergenic
1069877294 10:71570970-71570992 TTCTGAGCTCCTGTTAGGGATGG + Intronic
1070499731 10:77060993-77061015 TTTTGGCCTCCAGAAAAGGAAGG + Intronic
1070840935 10:79487473-79487495 TTCAGACCTCCTGTTAGGGATGG - Intergenic
1071678488 10:87680446-87680468 TTCTGTCTTACAGTTCAGGGTGG + Intronic
1073431062 10:103487405-103487427 TACTGTCCTCAAGTTATGAAAGG + Intergenic
1075339114 10:121631533-121631555 ATGTGTGCTCCAGTGAAGGAGGG - Intergenic
1076211246 10:128646717-128646739 ATCTGTCCTCCTCTGAAGGAAGG - Intergenic
1076633429 10:131867024-131867046 TTCTGTCCTCGAGTGTTGGAAGG + Intergenic
1079123163 11:17699374-17699396 ATCTGTCATCCAGGCAAGGAAGG + Intergenic
1079606905 11:22381013-22381035 TTCTATTTTCCAGGTAAGGAGGG + Intergenic
1081342660 11:41947349-41947371 CTCTGTCCTCCTAATAAGGAAGG - Intergenic
1083858056 11:65403587-65403609 TTCTGACCCCCAGTGTAGGATGG + Intronic
1088935241 11:114392978-114393000 TACAGTCCTCCAGCTAAGAATGG + Intronic
1088990627 11:114950383-114950405 TTCTGTCCCCAAGTGAAGAATGG + Intergenic
1090209838 11:124911042-124911064 TGTTGTCCTCCAGTTAAAGTAGG - Intergenic
1090221781 11:125032859-125032881 TGTGGTCCTCCAGTTAAAGAAGG - Intronic
1092868423 12:12784666-12784688 CCCTCTCCTCCAGATAAGGAGGG - Intronic
1093654378 12:21677684-21677706 TTCTGTCCTTGAGATAAGGCAGG + Intronic
1093742659 12:22706230-22706252 ATCTGTCCTCTAGTTAGGGGAGG + Intergenic
1093855298 12:24094554-24094576 TTATGACCTCAGGTTAAGGAAGG - Intergenic
1093903074 12:24658799-24658821 TCCTGTCTTCCAATTAATGAAGG + Intergenic
1093903217 12:24660670-24660692 TTGTGTCCTTCCCTTAAGGATGG + Intergenic
1094076682 12:26484022-26484044 AACTGTCCTCCACTTAAGGAGGG + Intronic
1095240944 12:39858122-39858144 TTCTGTCCACCTGTCATGGAAGG - Intronic
1095458953 12:42421222-42421244 TTCTGTCCTCAAGATAATGGAGG + Intronic
1096085208 12:48861120-48861142 TTCTGTCCTCCACTGAGGGGTGG + Exonic
1096627739 12:52905538-52905560 TTCTGTCATCCAGCTCAGGCAGG - Intronic
1097610853 12:61818066-61818088 TTCTGTTCTCCCGGTGAGGATGG - Intronic
1097930747 12:65182584-65182606 TTCAGTCCTGGAGATAAGGAAGG - Intronic
1098134585 12:67388855-67388877 TTCTGTGCTTGAGTTTAGGAGGG + Intergenic
1100813654 12:98364566-98364588 TTCTGTCTTCAAGTTCAGCACGG - Intergenic
1101350877 12:103929389-103929411 TTCTGTAAACCAGATAAGGAAGG + Intergenic
1101389137 12:104284284-104284306 TTCTGTACTCCACTTAAAGCAGG - Intronic
1102341512 12:112125654-112125676 CTGTGGCCTCCAGTTTAGGAAGG + Exonic
1102470668 12:113158166-113158188 TTCTGACCTCCAGGTGTGGAGGG + Exonic
1103035436 12:117652769-117652791 TGTGGTCCTCCAGTTAAGGTAGG + Intronic
1106509629 13:30401713-30401735 TTTTATCCTCCAGTTTTGGATGG - Intergenic
1107851866 13:44578233-44578255 TTCTGTCCTCCAGTTAAGGATGG - Intergenic
1108138081 13:47386570-47386592 TTGTGTCCTTCATTTCAGGATGG - Intergenic
1108438322 13:50423257-50423279 TTCTGTGTTGCAGCTAAGGATGG + Intronic
1109903984 13:68813852-68813874 TTCTGTCCTCCCATTAAACAGGG + Intergenic
1111426442 13:88090584-88090606 TCCTGTCCTCCATTTAGTGAAGG + Intergenic
1113036959 13:106061409-106061431 TTCTGCCCTCAAGCTAAGAATGG + Intergenic
1113537713 13:111081561-111081583 GTGTGTCCTCCAGTACAGGATGG + Intergenic
1113711677 13:112469379-112469401 CTCTGTGCACCAGTTAAGAAAGG + Intergenic
1114557237 14:23568999-23569021 TTCTCTCCTTCAGGGAAGGATGG + Exonic
1115130529 14:30047980-30048002 TTTGGTCCTCCAGTTAAAGTAGG + Intronic
1115137140 14:30124023-30124045 TTCTGTCCTGAAGCTAGGGAAGG - Intronic
1115918572 14:38345132-38345154 TTCTGTCTTCCTTTTAGGGAAGG - Intergenic
1116638265 14:47426011-47426033 TTGTGTCCTCCAGTCTGGGAGGG + Intronic
1118667423 14:68086023-68086045 CTCTGTCCTTGAGATAAGGAAGG - Intronic
1119528165 14:75339381-75339403 TCCTGTCTTACAGTTAAGCAAGG - Intergenic
1120154726 14:81080645-81080667 TTCTTTCCTCCAGTTACATATGG + Intronic
1120643339 14:87042198-87042220 TTCTATCTCCCAGTTAAAGAAGG - Intergenic
1126215963 15:46155468-46155490 TTCTGTTCTGCAGTGAAGTAAGG - Intergenic
1128814669 15:70598932-70598954 TCCTGTCCCCCAGTCAAGCAGGG - Intergenic
1129248081 15:74292176-74292198 TCCTTTCCTCCAGGTAAGGTGGG - Intronic
1130252688 15:82310613-82310635 CTCTGTCCTCCAGTTTAGACTGG + Intergenic
1136142718 16:28297826-28297848 TTCTGTCCTCAAGAAAGGGAAGG + Intronic
1143184092 17:5000207-5000229 CTCTGTCCTCCAGCTGAGGAGGG + Exonic
1143292338 17:5840825-5840847 CTCTGTCCTTCTGATAAGGAAGG - Intronic
1144965947 17:19077501-19077523 ATCTGTCCTCCAGTTATGAAGGG + Intergenic
1144982021 17:19174688-19174710 ATCTGTCCTCCAGTTATGAAGGG - Intergenic
1144986202 17:19203551-19203573 ATCTGTCCTCCAGTTATGAAGGG + Intergenic
1145050392 17:19654951-19654973 ATCTGCCCTCTAGTTCAGGAGGG - Intronic
1146973955 17:37095219-37095241 GTTTGTCCTCCAGTTAAGAGTGG - Intronic
1147441285 17:40448736-40448758 TTCAGTCTGCCAGTTAAGCAGGG + Intronic
1149236171 17:54593528-54593550 TGTTGTCCTCCAGTTAAAGTAGG - Intergenic
1150003568 17:61456336-61456358 TTCCCTCCTCCAGCTCAGGAGGG + Intronic
1150208122 17:63424579-63424601 CTCTGTCCTCCATTTCAGGGTGG - Exonic
1150787605 17:68175578-68175600 GTCTGACCTCCTGTGAAGGAAGG - Intergenic
1152029831 17:77835038-77835060 TCCAGGCCTCCAGTTAAGGGGGG - Intergenic
1152626683 17:81390836-81390858 TGCTGCCCTCCAGTTGAGGGAGG + Intergenic
1155239581 18:23852858-23852880 TTCTGTTCTCCAGTTGTGAAAGG + Intronic
1157564779 18:48672630-48672652 TTCTTGCCTCCAGGTAGGGAGGG - Intronic
1164883585 19:31758662-31758684 TTCTGTGGGCCAGATAAGGAGGG + Intergenic
1165104887 19:33463032-33463054 ATCCGTCCTCCAGGTAATGAAGG - Exonic
1168521460 19:57054144-57054166 CTCTGTCTTCCACTTAAGGGAGG + Intergenic
925460550 2:4059183-4059205 TGTGGTCCTCCAGTTAAAGAAGG + Intergenic
925626505 2:5846670-5846692 TTCTCTTCTCCAGTAAAGGTTGG - Intergenic
926097854 2:10094059-10094081 TCCTGGCCTCAGGTTAAGGAAGG - Intergenic
926716848 2:15931192-15931214 TTGTGTGCTACAATTAAGGATGG - Intergenic
927584036 2:24282511-24282533 TTCTGTCCTTGTGATAAGGAAGG + Intronic
927865407 2:26584598-26584620 TTCTGGACTCCATTTCAGGAAGG - Intronic
929945081 2:46364555-46364577 ATTTGTCCTCCTGTTAATGAGGG + Intronic
931111772 2:59118690-59118712 TTCTGTCATCCAATTTATGATGG + Intergenic
931534696 2:63260917-63260939 TACAGTCCTCAAGTTAAGAATGG + Intronic
935514597 2:104020884-104020906 TTCTGTCATCCTGTTAAGTAAGG + Intergenic
936780444 2:116026561-116026583 TTCTGTCCTCCACATAAAGGTGG + Intergenic
937224381 2:120359888-120359910 TTCTGAGCTCCAGTCCAGGATGG + Intergenic
937613384 2:123890941-123890963 TTCTGTCTTCCTTTTAATGAAGG + Intergenic
937800162 2:126073461-126073483 TGCAGTCCTCCAGTTAAAGTAGG + Intergenic
940599913 2:155845630-155845652 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
940631594 2:156246600-156246622 CTCTGTCTTACAGGTAAGGAAGG - Intergenic
943664905 2:190599173-190599195 TTCTGTCCTCTATTTATAGATGG - Intergenic
943801044 2:192057766-192057788 TTCTGTCCTACAGTCCATGAAGG - Exonic
944212061 2:197216670-197216692 TACTGTCTTCCAGTTATAGAAGG - Intronic
944778119 2:202989821-202989843 TTCTGTCCTCCAGGAAAGACAGG - Intronic
946822152 2:223641478-223641500 TTCTGCCCTGCAGTAAAGAAAGG + Intergenic
947916527 2:233835832-233835854 TTCTGTCATCCAGTGGAGGAAGG - Intronic
1172094586 20:32454445-32454467 TCCTGTCCTCCAGTAGAGAAGGG + Intronic
1174203698 20:48824803-48824825 TTCTGTCCTCAAGGAGAGGACGG - Intronic
1179123283 21:38568741-38568763 CTCTGTCCTCCAGCTCATGAAGG - Intronic
950017901 3:9767224-9767246 TGCTGTGCTCCAATTAAGGTTGG - Intronic
953931669 3:47008883-47008905 CTCTGTCCTCATTTTAAGGATGG - Intronic
955990342 3:64620413-64620435 TTTTGTCCTCCTTTTAAGAAGGG - Intronic
956789642 3:72670661-72670683 CTCTTTCCTCCAGTTAAGAGAGG + Intergenic
959541440 3:107544077-107544099 TTTTGTCCTGCAGTTCAGGGAGG + Intronic
960254443 3:115497145-115497167 TTCTTTCCTTCAGTGCAGGATGG - Intergenic
961662039 3:128474077-128474099 TTCTGTCCTTCAGATAAGCCTGG - Intergenic
962053787 3:131847312-131847334 GTCTCTCCTCCAGTAAAGAAGGG + Intronic
962452729 3:135534174-135534196 TTCTGTCCTCTAACAAAGGATGG + Intergenic
963630145 3:147721943-147721965 TCTTGTCCTCCAGTTAAAGTAGG + Intergenic
963661220 3:148130856-148130878 TGTTGTCCTCCAGTTAAAGTAGG + Intergenic
963675001 3:148299348-148299370 TTATGTCCTTCAGATAAGAAAGG - Intergenic
965547679 3:169932564-169932586 TTGTGTCCTACAGTTAGGAAGGG - Intronic
966366286 3:179191129-179191151 TTCTCTCCTCAAGTGAAGAAAGG - Intronic
969965780 4:10993913-10993935 TTCTGTCTTCCACTTAAGGATGG + Intergenic
971765158 4:30821494-30821516 TTCTGACATACAGCTAAGGATGG + Intronic
974459008 4:62163955-62163977 TGTGGTCCTCCAGTTAAGGTAGG + Intergenic
975172935 4:71253607-71253629 TCCTGTGCTCCAGTTACTGAGGG - Intronic
975927242 4:79471815-79471837 TTCTGTCTTTCAGTGAAGGAAGG + Intergenic
976621804 4:87135929-87135951 TTCTGTCCTTTAGTTAGGAAGGG - Exonic
977862086 4:101974243-101974265 TTCTATTCTTCAGTTATGGAGGG + Intronic
978068386 4:104435005-104435027 TTCTATCTTCCAGTTAAAAAGGG + Intergenic
978724974 4:111958966-111958988 TTCTGTCCTCATTTTAAAGATGG - Intergenic
980758600 4:137198733-137198755 TTCTGTCCTCCAGAGAGGCAAGG - Intergenic
984201711 4:176729582-176729604 TTCTGTCCTTGAGTTGAGGTTGG + Exonic
986937265 5:12904821-12904843 TGTGGTCCTCCAGTTAAGGTAGG + Intergenic
986938490 5:12920024-12920046 TGTGGTCCTCCAGTTAAGGTAGG - Intergenic
987347832 5:16994445-16994467 TTCTGTCTTGCAGTTCAGGCTGG + Intergenic
989617705 5:43354069-43354091 TGCTGTTCTCCAGTTCAGAATGG - Intergenic
990892396 5:60663133-60663155 TTTTGTCCCCTACTTAAGGAAGG + Intronic
991614597 5:68482843-68482865 TTCTCTCCTCCAGCTAAGCATGG - Intergenic
994301897 5:98157342-98157364 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
995332761 5:110964092-110964114 TTCTCTCCTCCCTTCAAGGAGGG - Intergenic
996226225 5:121000444-121000466 TTTTCTCCTCCACTTAATGAAGG - Intergenic
996808251 5:127482587-127482609 TTCTGCACTCATGTTAAGGAAGG - Intergenic
997806944 5:136927534-136927556 TTCTGACCTACAGTGGAGGAGGG - Intergenic
998171851 5:139877218-139877240 TCCTGCCCGCCAGTTCAGGAAGG + Intronic
999007272 5:147996675-147996697 TTCTGTCCTTGTGATAAGGAAGG - Intergenic
1002768523 6:266444-266466 TTCCCTCCACCAATTAAGGAGGG - Intergenic
1003225843 6:4204692-4204714 TTGTGACCTCCAGATATGGAAGG - Intergenic
1005438921 6:25844139-25844161 GTCTTTCCTCCACTTTAGGATGG + Intronic
1005712903 6:28519616-28519638 TTCTATCCATCAGTTAAAGAAGG + Intronic
1007224625 6:40304246-40304268 TTCTACCCTCAAGTTAAGAAAGG - Intergenic
1013327466 6:109061918-109061940 TTCTGTCCTCCACTAAAGTGAGG - Intronic
1014717991 6:124887925-124887947 TTCTGTCCTTGTGATAAGGAGGG + Intergenic
1015134972 6:129858504-129858526 TTCTGTCCTGCAGTGAGGGGTGG - Intronic
1015258518 6:131207715-131207737 TTCTGTCTCCCAGGTCAGGAGGG - Intronic
1019859945 7:3648945-3648967 TTCAGTGCTGCTGTTAAGGAAGG + Intronic
1022091675 7:27111640-27111662 TTCTTTCCCCCAGTTACAGAAGG + Intronic
1024364417 7:48504791-48504813 TTCTGACCTCCTGATAAGGTTGG + Intronic
1027294914 7:76760186-76760208 TTGTGTACACCAGTTAAGGAAGG + Intergenic
1030618196 7:111760800-111760822 TGCTCTCCTTCAGTTAAGAATGG + Intronic
1030634919 7:111938021-111938043 TTATGACCACCAGTTAAGTATGG + Intronic
1033787046 7:144744658-144744680 TTCTGACTTCCAGTGAAGGGAGG - Intronic
1037484065 8:19330991-19331013 ATGTGGCCTCCAGGTAAGGAGGG - Intronic
1037792211 8:21955483-21955505 TTCTGTCCTCAGGTTAAAGTAGG + Intronic
1038365079 8:26923407-26923429 CTTTGTCCTGGAGTTAAGGAAGG - Intergenic
1038664262 8:29523999-29524021 TGGTGACCTCCAGATAAGGAAGG + Intergenic
1039853006 8:41387526-41387548 TGCTGTTCTCCTGATAAGGAAGG + Intergenic
1042431032 8:68706634-68706656 GTCTGTCCTTGGGTTAAGGAAGG + Intronic
1043126328 8:76400360-76400382 TTCTGTCCTACACATAAAGAGGG - Intergenic
1043257832 8:78158071-78158093 TGTGGTCCTCCAGTTAAGGTTGG + Intergenic
1043775245 8:84259126-84259148 TTCTTTCCTCCAGAGAACGATGG - Intronic
1044150633 8:88771788-88771810 TGTTGTCCTCCAGTTAAAGTAGG + Intergenic
1044487325 8:92768413-92768435 TTTGGTCCTCCAGTTAAAGTAGG - Intergenic
1046455206 8:114450210-114450232 GTATGTTCTCCAGTTAAAGAGGG - Intergenic
1046918094 8:119698917-119698939 TTGTCTCCACCAGGTAAGGAGGG - Intergenic
1048491201 8:134895513-134895535 TTGTGACCTCCAGGTAAGGCTGG + Intergenic
1048624650 8:136171868-136171890 TCCTGTCATCCAATTGAGGAAGG - Intergenic
1048984445 8:139727286-139727308 ATCTTTCCTCCAGTTTTGGAAGG + Intergenic
1051338082 9:16085092-16085114 TGCTGCCCTCCAGTTCAGTAGGG - Intergenic
1052940071 9:34126180-34126202 ATCTGCCCTCCAGTTAACGAGGG + Intronic
1053396598 9:37780385-37780407 TGCTGACCTCCAGTTAATTATGG + Exonic
1053424377 9:38001513-38001535 TTCTGTCCTTCAGACAAGGATGG + Intronic
1054730498 9:68698088-68698110 TTCTGTCTTGCAGTTCAGGAAGG + Intergenic
1055564163 9:77551327-77551349 CTCTGTCCTGCAGATAAGCAGGG + Intronic
1055836655 9:80451384-80451406 CTCTGTACTCCAGTAAAGTAAGG - Intergenic
1055904598 9:81278096-81278118 GTCTGTCTTCCTCTTAAGGAAGG + Intergenic
1056239779 9:84633052-84633074 TTTTCTACTCCAGTAAAGGATGG - Intergenic
1057054714 9:91951355-91951377 TTTTGCCATCCAGTTGAGGAGGG - Intergenic
1058454910 9:105129995-105130017 AACAGTCCTCAAGTTAAGGATGG + Intergenic
1060959849 9:127672536-127672558 TTCCAGCCTACAGTTAAGGAGGG + Intronic
1061804545 9:133130853-133130875 TTCTGGCCCCCAGGTCAGGATGG - Intronic
1061841053 9:133358803-133358825 TTCTGGAGTCCAGCTAAGGAGGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1188359853 X:29239961-29239983 TTCCTTCTTCCACTTAAGGATGG + Intronic
1190729487 X:53215967-53215989 TTCTCTCTCCCAGATAAGGAGGG - Exonic
1191163240 X:57358070-57358092 TTCTTTCCTTCAGATAAGGTTGG + Intronic
1192521352 X:71804206-71804228 TCCTCTCCTCAAGTGAAGGAAGG - Intergenic
1192898544 X:75470620-75470642 TACGGTCCTCCAGTTAAAGTAGG + Intronic
1193320178 X:80112814-80112836 ATCTGTACTACAGTAAAGGATGG + Intergenic
1193751632 X:85352861-85352883 TTCTGTCCTCAAGCTAAAAATGG + Intronic
1193877120 X:86874025-86874047 TTTGGTCCTCCAGTTAAAGTAGG + Intergenic
1194050276 X:89059584-89059606 TTCTTTCCTCCAGTATAGGGTGG + Intergenic
1194221645 X:91200500-91200522 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1195166876 X:102228795-102228817 TTCTGTTCACCATTTAGGGATGG + Intergenic
1195191984 X:102458293-102458315 TTCTGTTCACCATTTAGGGATGG - Intronic
1195217832 X:102717835-102717857 TTCTGTTCTTGAGTTAAGAAGGG + Intergenic
1197425914 X:126296907-126296929 TGTTGTCCTCCAGTTAAAGTAGG - Intergenic
1198271017 X:135056053-135056075 TTCTGTCCTTTTGATAAGGAAGG + Intergenic
1198933847 X:141886561-141886583 TTTGGTCCTCCAGTTAAAGTAGG + Intronic
1199457315 X:148043803-148043825 TTGTGTCCTTCCCTTAAGGATGG + Intergenic
1200558160 Y:4664256-4664278 TTCTGTCCTTGTGATAAGGAAGG + Intergenic
1201194020 Y:11474174-11474196 TTCTGGCTGCCAGGTAAGGAAGG - Intergenic