ID: 1107854724

View in Genome Browser
Species Human (GRCh38)
Location 13:44603490-44603512
Sequence CTATAAAAATAAATTGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1336
Summary {0: 3, 1: 2, 2: 13, 3: 156, 4: 1162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107854720_1107854724 4 Left 1107854720 13:44603463-44603485 CCTAGGCTACATAGCAAGACCCT No data
Right 1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG 0: 3
1: 2
2: 13
3: 156
4: 1162
1107854719_1107854724 8 Left 1107854719 13:44603459-44603481 CCAGCCTAGGCTACATAGCAAGA No data
Right 1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG 0: 3
1: 2
2: 13
3: 156
4: 1162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107854724 Original CRISPR CTATAAAAATAAATTGAGGC CGG Intergenic
900514597 1:3075348-3075370 TTATTAAAATAAATTGCAGCCGG - Intronic
901013823 1:6216313-6216335 CTGCAGAAATAAATTGAGGCTGG + Intronic
901476158 1:9491017-9491039 CTGAAAAAATAAAATAAGGCTGG + Intergenic
901527387 1:9832267-9832289 ATACAAAAAAAAATTTAGGCGGG + Intergenic
901538453 1:9899157-9899179 TTAAAAATATAAAATGAGGCCGG + Intronic
901687516 1:10951266-10951288 CTATAAAAAATATTTAAGGCTGG + Intronic
901859733 1:12066647-12066669 AAATAAAAAAAAATTTAGGCCGG - Intronic
902945669 1:19835910-19835932 ATTTTAAAATAAATTTAGGCTGG + Intergenic
903530160 1:24023985-24024007 TTATATAAATATTTTGAGGCCGG + Intergenic
903554397 1:24182623-24182645 GTAAAAAAATAAATACAGGCCGG + Intronic
903709904 1:25315790-25315812 CTAGAAAAATAAATTAAGGCCGG - Intronic
903717211 1:25376616-25376638 CTAGAAAAATAAATTAAGGCCGG + Intronic
903941268 1:26933227-26933249 TTAAAAAAAAAAATTGTGGCCGG - Intronic
903997570 1:27317206-27317228 CTATAAAATGGAATGGAGGCCGG + Intergenic
904589520 1:31603254-31603276 CAATTAAAAAAATTTGAGGCCGG - Intergenic
904663647 1:32103517-32103539 CAAAAAAAATAAAATAAGGCCGG + Intergenic
904725206 1:32541552-32541574 CTATAAAAATACTTTGGGACTGG + Intronic
904765915 1:32846508-32846530 CTACAAAAATTAAATGAGTCAGG - Intronic
904951716 1:34246677-34246699 AGAGAAAAATAAATTGAGGCAGG + Intergenic
905103536 1:35546581-35546603 CAATAAATATTTATTGAGGCAGG - Intronic
905210696 1:36372185-36372207 CTAGAAAAAGAAATTGAGCCCGG + Intronic
905238139 1:36564613-36564635 AAATAAAAATAAAGTGAGGTGGG - Intergenic
905459075 1:38109799-38109821 ATATAAAAATACCTTAAGGCTGG - Intergenic
905738220 1:40346106-40346128 CTTTAAAAGTATATTGTGGCTGG - Intronic
905811910 1:40919297-40919319 TTAAAAAAATAAAATAAGGCCGG - Intergenic
906350439 1:45054284-45054306 CAATAAAAATAAATTTGGCCTGG + Intronic
906485764 1:46233581-46233603 TTTTAAAAATAAAATGAGGCTGG - Intergenic
906489077 1:46253920-46253942 CTATAATAATATAATCAGGCTGG - Intronic
906555827 1:46712709-46712731 CTTAAAAAATATATTTAGGCAGG + Intronic
907009273 1:50948275-50948297 CTATAAAAAAAATCTGAGGCTGG + Intronic
907346659 1:53787350-53787372 ATATAAAAAGAAATAAAGGCTGG + Intronic
907369227 1:53989016-53989038 GTGCAAAAAGAAATTGAGGCAGG - Intergenic
908060765 1:60346064-60346086 CTATAAAACTCAATTGATGGGGG + Intergenic
908189919 1:61691617-61691639 ATATAAAAATATAAGGAGGCTGG + Intronic
908203396 1:61820636-61820658 TAATAAAAATAAATGTAGGCCGG - Intronic
908350720 1:63284631-63284653 TAAGAAAAATAAAATGAGGCCGG - Intergenic
908562581 1:65321491-65321513 TTAAAAAATTAAATTTAGGCTGG - Intronic
908614455 1:65903352-65903374 CTTTAAAAATAAATATAGCCTGG + Intronic
909026934 1:70493181-70493203 GTATAAAAATAACTTCAGTCTGG - Intergenic
909645071 1:77908076-77908098 CTTTAAAAAAAAATAGAGACAGG - Intronic
909735015 1:78947861-78947883 CTTTAAAAAGAAATTAAGCCTGG - Intronic
909938864 1:81587810-81587832 CTGTGAAAATAAATTAAGGAGGG + Intronic
910690051 1:89956479-89956501 CTAAAAAAAAAAAATGAGCCAGG + Intergenic
910878703 1:91903033-91903055 AAAAAAAAAAAAATTGAGGCCGG + Intronic
910924903 1:92388387-92388409 AAATAAAAATAAATTGAAGATGG + Exonic
911320420 1:96407449-96407471 CTATAAAAATAATATAATGCAGG + Intergenic
911336869 1:96591639-96591661 CTAAAAACATAAAATTAGGCAGG + Intergenic
911639829 1:100276129-100276151 TTAAAAATATAAACTGAGGCTGG - Intronic
911746204 1:101444455-101444477 CTCAAAAAAAAAATTTAGGCTGG - Intergenic
912322215 1:108724782-108724804 ATTAAAAAATAAATTTAGGCTGG + Intronic
912422947 1:109558445-109558467 ATTTAAAAATAAATTGAAGTAGG + Intronic
912783175 1:112572702-112572724 CTTTAAAAAAAAATAGAGACAGG - Intronic
913291500 1:117276924-117276946 TTAAAACAATAAAATGAGGCTGG + Intergenic
913597851 1:120395241-120395263 TTAAAAAAAAAAATAGAGGCTGG - Intergenic
914089480 1:144484071-144484093 TTAAAAAAAAAAATAGAGGCTGG + Intergenic
914309129 1:146450124-146450146 TTAAAAAAAAAAATAGAGGCTGG - Intergenic
914592980 1:149123003-149123025 TTAAAAAAAAAAATAGAGGCTGG + Intergenic
914724784 1:150318490-150318512 CTAAAAATACAAAATGAGGCCGG + Intergenic
914816742 1:151068879-151068901 ATAGAAAGATAAAATGAGGCCGG - Intronic
915099259 1:153487031-153487053 TTAAAAAAAAAAATTTAGGCCGG + Intergenic
915149861 1:153821860-153821882 CTTTAAAAATGAATTCAGGCCGG - Intronic
915178825 1:154040745-154040767 CAATAAAAAAAAATTTAGCCGGG - Intronic
915182472 1:154074392-154074414 GAAGAAAAATAAATTGAGGAAGG - Intronic
915191292 1:154153088-154153110 CTTTTAAAAAAAATTGAGGGAGG - Intronic
915397348 1:155595472-155595494 AAAGAAAAAGAAATTGAGGCCGG - Intergenic
915576326 1:156780609-156780631 CTAAAAATATAAATTTAGTCAGG - Intronic
915725725 1:158015812-158015834 CAAGAGAAATAAATTGAGGTTGG - Intronic
916099909 1:161385792-161385814 TTAAAAAAATAACTTTAGGCTGG - Intergenic
916679707 1:167093291-167093313 CTATTAAAAGAAATGCAGGCAGG + Intergenic
917769108 1:178257539-178257561 TTATAAAAATTAATGTAGGCTGG + Intronic
917769653 1:178263724-178263746 TTAAAAAAAAAAATTGAGACAGG + Intronic
917964605 1:180170377-180170399 CCATAAAAATATCTGGAGGCTGG + Intronic
918491591 1:185087178-185087200 CTATAAAAAATACTTTAGGCTGG + Intronic
918823513 1:189291326-189291348 CTATAAAAAATACTTGAGACTGG + Intergenic
918920640 1:190705186-190705208 CTATAAAAATAAATTCCAGATGG + Intergenic
919053212 1:192537184-192537206 ATAAATAAATAAATTGAGGTGGG - Intergenic
919203607 1:194391703-194391725 CTATTAAAAAAAATTGAGGAGGG + Intergenic
919292040 1:195644543-195644565 CTAAAAAAGTAAATTGATACTGG - Intergenic
919338160 1:196266725-196266747 TGAAAAAAATAAATGGAGGCTGG + Intronic
919629153 1:199943202-199943224 CTAAAAAAAAAAATTTAGACTGG - Intergenic
920085934 1:203416952-203416974 ATACAAAAATTAATTGAGGATGG + Intergenic
920628396 1:207626739-207626761 CTAAGAAACTAAAATGAGGCTGG + Intronic
920638536 1:207728952-207728974 CTAAGAAACTAAAATGAGGCTGG + Intronic
920818639 1:209359592-209359614 CTATAATATTAAATTGAGTGAGG - Intergenic
920930278 1:210381575-210381597 CCTTAAAAATGATTTGAGGCCGG - Intronic
921210870 1:212896719-212896741 CTATAAAGAAATATTTAGGCTGG + Exonic
921471514 1:215556322-215556344 CTATAAAAGCAAATTCAGGCCGG - Intergenic
921767459 1:218989556-218989578 GTATAAAAATAAAATGATACAGG - Intergenic
921805165 1:219445837-219445859 TTATAAAAATAAAACAAGGCCGG - Intergenic
921954467 1:220967733-220967755 CTATAAAATGAAACTGAGGTGGG + Intergenic
922353821 1:224757516-224757538 CAATTAAAATAAAATCAGGCCGG - Intergenic
922664852 1:227459944-227459966 CTACAAAAACAAATTTAGCCAGG + Intergenic
923168198 1:231387653-231387675 CCTTAAAAATAAGTTGCGGCCGG - Intronic
923415433 1:233753372-233753394 CTAAAAAAATAAATGGACACAGG + Intergenic
924323404 1:242871596-242871618 TTCTAAAAATACATTGAAGCAGG + Intergenic
924623143 1:245679763-245679785 CTTTGAAAATAAATTTATGCTGG - Intronic
924755149 1:246933558-246933580 CTACAAAAATAAAAATAGGCTGG - Intergenic
924784393 1:247182142-247182164 ATATTAAAAGAATTTGAGGCTGG - Intergenic
1062895811 10:1102393-1102415 CTATAAAAAATACTTGAGACAGG + Intronic
1063140051 10:3248057-3248079 CTGTAAAAATAAGAAGAGGCCGG + Intergenic
1063480249 10:6369260-6369282 CTAGAAAAATAAATTCAGAAAGG - Intergenic
1064028495 10:11868434-11868456 CTACAAAAAAAAATTTAGCCAGG - Intronic
1064597288 10:16958647-16958669 CTATAAAAATAAAGACAGGGAGG + Intronic
1064616874 10:17168005-17168027 TTATAAATATGAATGGAGGCTGG + Intronic
1065221784 10:23503245-23503267 ATATAAAAATAAAATTAGCCGGG - Intergenic
1065274893 10:24075898-24075920 CAATAAAAATAGATTAAGGCTGG - Intronic
1065300566 10:24317413-24317435 CCATAAAAATAAAATTAAGCTGG - Intronic
1065627938 10:27650381-27650403 CTATAAAAAAAAATAGAGCTGGG + Intergenic
1065959305 10:30721478-30721500 CTTAAAAAATAAAGAGAGGCTGG + Intergenic
1066118383 10:32260263-32260285 ATAAAAAAATAAAATGAGGCTGG - Intergenic
1066934159 10:41804734-41804756 ATATAAAAATTAATTGAAGATGG - Intergenic
1067898273 10:50210202-50210224 CCATAAAAAAAGAATGAGGCTGG + Intronic
1068222471 10:54061926-54061948 CTTTAAAAACTAAATGAGGCCGG + Intronic
1068236383 10:54239167-54239189 CTATAGAAATAAATAGATGAAGG - Intronic
1068769665 10:60806834-60806856 TTTTAAAAATAAAATAAGGCCGG - Intergenic
1068999230 10:63244838-63244860 CAATTAAAAGAAATTAAGGCTGG + Intronic
1069015935 10:63429139-63429161 CTAAAAATATAAAATTAGGCAGG - Intronic
1069077626 10:64054661-64054683 CTATAAAACTAACTTGAGAATGG - Intergenic
1069297993 10:66871260-66871282 TTATACAAAGAAATTTAGGCTGG + Intronic
1069328512 10:67261648-67261670 CTATAAAAATGATTTGATTCAGG - Intronic
1069429125 10:68317929-68317951 ATAAAAAAATAAAGTAAGGCCGG + Intronic
1069451080 10:68518477-68518499 ATCCAAAAATAAATTGTGGCTGG + Intronic
1069521149 10:69123055-69123077 ATTTAAAAATAAGTTGAGGCCGG - Intergenic
1069647228 10:70009472-70009494 CTACAAAAATAAAATTAGCCGGG + Intergenic
1069958329 10:72065024-72065046 CTCAAAAAATAAAATAAGGCTGG - Intronic
1069970624 10:72165275-72165297 CTAAAAACATAAAATTAGGCGGG - Intronic
1070195937 10:74156452-74156474 CTACAAAAATAAACTTAGCCAGG + Intronic
1070310151 10:75267076-75267098 ATAAAAAAATAAATTGACGGTGG + Intergenic
1070535846 10:77376639-77376661 TTAAAAAAAAAAAATGAGGCCGG + Intronic
1070639743 10:78159093-78159115 TTAAAAAAATATATTCAGGCTGG - Intergenic
1070937593 10:80313505-80313527 CTATAAAAAATACCTGAGGCTGG + Intergenic
1071769690 10:88713642-88713664 ATGTAAAAATAAATTTAGGCTGG + Intergenic
1071808977 10:89157373-89157395 CTTTAAAAATAAATAGAGTCAGG + Intergenic
1072014977 10:91337671-91337693 CTAAAAAAAAAAATTGGGCCAGG + Intergenic
1072104926 10:92264868-92264890 CTATAAAAAAAATTTAAGGTCGG + Intronic
1072110332 10:92313603-92313625 CTAAAAAAAAAAATTGTGGCGGG + Intronic
1072604658 10:96970099-96970121 CTATTAAATTGACTTGAGGCTGG + Intronic
1073553391 10:104424908-104424930 CTAAAAACATACATTAAGGCAGG + Intronic
1073805019 10:107088182-107088204 TAAAAAAAATAAATTCAGGCCGG - Intronic
1073805141 10:107089614-107089636 TTATATAAATAAATTAAGGAAGG + Intronic
1074046642 10:109845448-109845470 CTTTAAAAATAACTTGTGGAGGG + Intergenic
1074064758 10:110004236-110004258 TTAAAAAAAAAAATTGAGGCCGG + Intronic
1074084249 10:110195640-110195662 TTAAAAAAAAAAATTGAGACAGG - Intergenic
1074124966 10:110521540-110521562 TTATATTAATAAATTGAGGTCGG + Intergenic
1074220088 10:111428195-111428217 TTATGAAATGAAATTGAGGCCGG + Intergenic
1074381330 10:112983173-112983195 TTAAAAAAATAAATTTAGGCCGG + Intronic
1074396320 10:113100912-113100934 CTAAAAATATAAAATTAGGCAGG + Intronic
1074443441 10:113498466-113498488 TTCAAAAAATAAATTGAGGCCGG - Intergenic
1074485323 10:113871469-113871491 GTTTAACAATAAATTGAGGTGGG - Intronic
1074620123 10:115110137-115110159 ATATAGAAATAAACTGAGGTAGG + Intronic
1075028938 10:119008003-119008025 CTATTATAAAAAATTCAGGCCGG - Intergenic
1075043052 10:119123893-119123915 GTTTAAAAAAAAATTGTGGCCGG + Intronic
1075371997 10:121945168-121945190 CTACAAAAAAAAATTTAGGCCGG - Intergenic
1075756356 10:124814939-124814961 TTATAAAAATAAATTAAAGCCGG - Intronic
1076227110 10:128786973-128786995 CTATAAAAGTAGAATAAGGCCGG - Intergenic
1076649062 10:131974870-131974892 TTATAAATAGAAACTGAGGCTGG + Intronic
1076748320 10:132526050-132526072 TTAAAAAAATAAAATAAGGCTGG + Intergenic
1077004274 11:344564-344586 TTATAAAAAAAAATTGGGCCCGG + Intergenic
1077086505 11:754766-754788 TTAAAAAAATAAATTCAGGCCGG - Intronic
1077087566 11:762124-762146 CTAAAAATATAAAATTAGGCGGG - Intronic
1077578264 11:3400637-3400659 AAATAAAAATAAATTGAGGAAGG + Intergenic
1077820886 11:5739399-5739421 AAATAAAAATAAAATTAGGCAGG + Intronic
1077891395 11:6420329-6420351 ATGAAACAATAAATTGAGGCTGG - Intergenic
1077965979 11:7134056-7134078 CTTAAAAAAAAAATAGAGGCAGG + Intergenic
1078014303 11:7599938-7599960 CTAAAAAAGGTAATTGAGGCCGG - Intronic
1078301728 11:10137708-10137730 TTTAAAAAATAAATTGAGGCCGG + Intronic
1078484494 11:11708929-11708951 CTTTAAAAATAAATGGATGAGGG - Intergenic
1078573287 11:12477389-12477411 CCATAAAAAAAATTTTAGGCTGG - Intronic
1078593825 11:12669806-12669828 CTTTGAAAAAAAATTGTGGCTGG + Intergenic
1079243082 11:18734475-18734497 ATAAAAAAATAAATTTAGCCAGG - Intronic
1080069980 11:28070884-28070906 ATTAAAAAATAAATTTAGGCTGG + Intronic
1080525334 11:33110932-33110954 CTATAAAAATAAAAGCAGGCCGG + Intronic
1080674149 11:34409261-34409283 AGATGAAAATAATTTGAGGCTGG + Intergenic
1081054695 11:38394992-38395014 CTTTAAAAACAAATTTGGGCTGG - Intergenic
1081175930 11:39926655-39926677 CTTTAAAAAAAAATCGAGCCGGG + Intergenic
1081182951 11:40006657-40006679 CTAGAAAAGTAAATTGTGGCTGG + Intergenic
1081602665 11:44506155-44506177 CTATAAAAAAAAACTGAAACTGG - Intergenic
1081859456 11:46324304-46324326 TTAAAAAAAAAAATTGTGGCCGG - Intergenic
1082151516 11:48745849-48745871 ATATAAAAATAAATTCAAGATGG - Intergenic
1082172650 11:49024836-49024858 CTATGAAAATGCTTTGAGGCTGG + Intergenic
1082992452 11:59219668-59219690 TTTTAAAAATAAGTTGAGGCTGG + Intergenic
1083230853 11:61317799-61317821 TTTAAAAAATAAATTTAGGCTGG - Intronic
1083327625 11:61880996-61881018 CTTTAAAAAAAAAATTAGGCTGG - Intronic
1083481775 11:62953046-62953068 CAATAAAAAGAAATGGGGGCCGG - Intronic
1083624636 11:64065997-64066019 CTATAAAGATGAATTTAGGCCGG + Intronic
1083676046 11:64325524-64325546 CTAAAAAAATAAAAATAGGCCGG + Intergenic
1084129744 11:67124298-67124320 ATATAAAAATAAAGTGAAGCCGG - Intronic
1084230630 11:67750128-67750150 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
1084235253 11:67783839-67783861 AAATAAAAATAAACTGAGGAAGG + Intergenic
1084280323 11:68086017-68086039 CTTTAAAAATAAAATGGGCCAGG + Intronic
1084306278 11:68286147-68286169 CTAAAAAACTAAAATAAGGCTGG - Intergenic
1084865927 11:72057445-72057467 CTTTAAAAATCAATTAAAGCTGG + Intronic
1084983393 11:72845805-72845827 CCATAAAAATATACTGAAGCTGG - Intronic
1085104416 11:73829923-73829945 CTACAAAAATATAATGAGCCGGG - Intronic
1085137830 11:74109774-74109796 AAATAAAAAGAATTTGAGGCCGG + Intronic
1085321666 11:75578053-75578075 CTATATTAATAAATTCAGCCCGG - Intergenic
1086209809 11:84306380-84306402 CTATACACATAGATTGATGCAGG + Intronic
1086381403 11:86258850-86258872 ATAAATAAATAAATAGAGGCAGG - Intronic
1086428513 11:86712425-86712447 CTTTAAAAATAAATGAATGCTGG - Intergenic
1087421135 11:97926241-97926263 ATATAAAAATTAATTCAGGATGG + Intergenic
1087605222 11:100369236-100369258 CCATAATAAAAACTTGAGGCTGG + Intergenic
1087696633 11:101385086-101385108 CTCTAGAAATAATATGAGGCAGG - Intergenic
1088241266 11:107775872-107775894 CTATAAAAAAAAAATCTGGCCGG + Intergenic
1088520013 11:110687229-110687251 CTATAAAAAAAAAATTAGCCGGG - Intronic
1088605156 11:111522822-111522844 TAAAAAAAAAAAATTGAGGCTGG + Intronic
1088615232 11:111619639-111619661 ATTTAAAAAGAAAATGAGGCTGG - Intronic
1088925756 11:114300515-114300537 CTATAAATATCAATTAAGTCAGG + Intronic
1089042444 11:115465131-115465153 CAATAAAAATAATATGATGCAGG - Intronic
1089482128 11:118814560-118814582 ATATAAAGATTAATTGAGGCTGG - Intergenic
1089886742 11:121832337-121832359 AGATCAAAATAAATTGAGGGAGG - Intergenic
1089935194 11:122357489-122357511 TTCTAAAAATAGAATGAGGCTGG + Intergenic
1090062797 11:123478174-123478196 CTATAAAAAAAAAATTAGCCAGG - Intergenic
1090622264 11:128571130-128571152 CTAAAAAAAGAACTTCAGGCTGG + Intronic
1090766400 11:129879889-129879911 CTCTAAAACTAAAGTCAGGCTGG + Intronic
1090779420 11:129994172-129994194 GTATGAAAATAAACTGGGGCTGG + Intronic
1091144966 11:133271187-133271209 CTATAAAAATGTTTTGAGGTAGG - Intronic
1091725332 12:2842569-2842591 CTACAAAAAAAAATTCAGCCAGG + Intronic
1091725560 12:2844255-2844277 CAAAAAAAATAAAATAAGGCTGG + Intronic
1091828097 12:3530254-3530276 CTATAATAATAAATTTATGAAGG + Intronic
1092507614 12:9120112-9120134 CTATAAAAATTAATTTACACTGG - Intergenic
1092798973 12:12144478-12144500 CTACAAAAATAAAATTAGCCGGG + Intronic
1092866386 12:12765346-12765368 ATATAAAAATATATTGAGCCGGG - Intronic
1093565935 12:20603873-20603895 CTAAAGAAATAAAATGAGCCAGG + Intronic
1093572230 12:20679542-20679564 CTAAAAAATTAATTTCAGGCTGG - Intronic
1093804440 12:23415045-23415067 CTAGAAATAAAAATTGATGCTGG + Intergenic
1094225075 12:28036092-28036114 CGATAAAAAAAAATTGTCGCTGG + Intergenic
1094237176 12:28182148-28182170 CTATAAACAAAAATTTATGCTGG - Intronic
1094496995 12:30994812-30994834 TTATAAAAGGAAATTAAGGCTGG + Exonic
1094540277 12:31357603-31357625 CTACAAAAATAAAATTAGCCAGG - Intergenic
1094565259 12:31592630-31592652 CTATAAAAATAAAATGAGGCCGG + Intergenic
1095101688 12:38191363-38191385 CTATAAAAATAATTGGTGGCTGG - Intergenic
1095226834 12:39687287-39687309 CTATAAAAAATACTTGAGACTGG + Intronic
1095256335 12:40041111-40041133 CTAAAAAAATAAAATTAGCCGGG - Intronic
1095435208 12:42179541-42179563 CTAAAAATAGAAATTGAGGTGGG + Intronic
1095772003 12:45970188-45970210 ATAAAAAAATTAGTTGAGGCCGG - Intronic
1095772120 12:45971613-45971635 CTCTAAATATAAAGTGAGGTGGG + Intronic
1096184506 12:49569528-49569550 TTATAAAAATTATTTCAGGCCGG - Intronic
1096312604 12:50534658-50534680 CTCTAAAAACCAACTGAGGCCGG - Intronic
1096644079 12:53019100-53019122 CTAGAAATATAATTTAAGGCCGG + Intronic
1096925590 12:55141197-55141219 CTACAAAAATAAATTCAAGATGG + Intergenic
1097087050 12:56476581-56476603 AAAAAAAAAAAAATTGAGGCAGG - Exonic
1097093128 12:56523481-56523503 CTTTAAAAAAGAAATGAGGCTGG + Intronic
1097097418 12:56560548-56560570 ATACAAAAATTAGTTGAGGCAGG - Intronic
1097676819 12:62611886-62611908 GTTTAAAAATAAATAGAGGCAGG + Intergenic
1097767289 12:63540678-63540700 TTATAAAGAGAAATTGAAGCAGG - Intergenic
1097778939 12:63681566-63681588 AAAAAAAAAAAAATTGAGGCCGG + Intergenic
1097783660 12:63735718-63735740 TTATAAAGAGAAATTGAAGCAGG - Intergenic
1098526647 12:71494240-71494262 CTACAAAAAAAAATCAAGGCCGG - Intronic
1098537618 12:71612172-71612194 CTTTAAAAAAAAATTGGGGTGGG - Intronic
1098821747 12:75239817-75239839 CTTTAAAAATAGAGTGAGACAGG - Intergenic
1098974119 12:76884569-76884591 ACATAAAAATAAATGTAGGCTGG + Intergenic
1099456524 12:82869541-82869563 CTCTTAAAAGAATTTGAGGCCGG + Intronic
1099459687 12:82907165-82907187 CTTTAAGAATGAATTGGGGCCGG + Intronic
1100277514 12:93084821-93084843 ATATAAAAAAATTTTGAGGCCGG + Intergenic
1100284909 12:93156009-93156031 ATATTAAAAAAAATTCAGGCTGG - Intergenic
1100316362 12:93448500-93448522 CTATAAAAGTAAATGGAGCCGGG + Intergenic
1100356390 12:93834782-93834804 ATATAAAACTAATTTTAGGCTGG - Intronic
1100468428 12:94869868-94869890 CTATAAAGAGAACTTGGGGCTGG + Intergenic
1100482534 12:94993190-94993212 CTAAAAAAATAAATAAAAGCTGG + Intronic
1100823349 12:98452528-98452550 CAATAAAATAAAATTGAGGCCGG - Intergenic
1101442091 12:104711461-104711483 CTTTAAAAAAAAAATGAGCCTGG - Intronic
1101948819 12:109158675-109158697 CTATAAAAAACAAATAAGGCTGG + Intronic
1102080629 12:110095071-110095093 CTTAAAAAAAAAATAGAGGCCGG - Intergenic
1102104256 12:110307053-110307075 CAAGAAAAAGAAATTGTGGCCGG - Intronic
1102110151 12:110359217-110359239 CCATCAAAATAAGTAGAGGCTGG + Intergenic
1102170836 12:110841468-110841490 TTGTACAAATAAACTGAGGCAGG - Intergenic
1102270668 12:111532182-111532204 TTCTAAAAATAATTTGAGGCCGG + Intronic
1102350374 12:112187532-112187554 CCATAAAAATAAATACAGGCCGG - Intronic
1102358995 12:112267359-112267381 CATTAAAAAAAAATTGAGACAGG + Intronic
1102622078 12:114204058-114204080 CTATAAAAAATACCTGAGGCTGG - Intergenic
1102662980 12:114545839-114545861 CTCAAAAAAAAAATTGAGGAGGG - Intergenic
1102836169 12:116062740-116062762 TTTTAAAAATATACTGAGGCCGG - Intronic
1102867609 12:116386559-116386581 CTCAAAAAATAAAATAAGGCTGG - Intergenic
1102899230 12:116623427-116623449 TTATAAGAAGAAAATGAGGCTGG + Intergenic
1102907589 12:116688672-116688694 CTAAAAATATAAATTTAGCCAGG - Intergenic
1103116064 12:118333837-118333859 AAAAAAAAAAAAATTGAGGCTGG + Intronic
1103116800 12:118341294-118341316 TTAAAAAAAAAAATTTAGGCTGG - Intronic
1103315996 12:120056422-120056444 CTATAAGAATGAATTGAGGCCGG + Intronic
1103487351 12:121292279-121292301 CAATAAAAATTAGTTGAGCCTGG - Intronic
1103509338 12:121463874-121463896 CTATAAAAATGACTACAGGCTGG - Intronic
1103516308 12:121510494-121510516 GTCTAAAAATAAGTCGAGGCTGG + Intronic
1103582609 12:121926622-121926644 CAAAAAGAAAAAATTGAGGCCGG - Intronic
1103591948 12:121998045-121998067 AAAAAAAAATCAATTGAGGCCGG - Intronic
1103594471 12:122015741-122015763 ATAAAAAAATAAAGTTAGGCTGG + Intergenic
1103707063 12:122881441-122881463 CTCTAAAAATAAATTATGCCAGG + Intronic
1104060131 12:125260751-125260773 ATATTAAAATAAATAAAGGCTGG + Intronic
1104061941 12:125276008-125276030 CTTTAAAAATAATTTTAGGCTGG - Intronic
1104413036 12:128575181-128575203 TTATAAATATAAAGAGAGGCCGG + Intronic
1104666998 12:130654689-130654711 CTATAAAGAAATACTGAGGCTGG + Intronic
1105036518 12:132927658-132927680 CTCTAAAAAAAAAATAAGGCTGG - Intronic
1105478379 13:20749024-20749046 CTTTAAAACTACATTGGGGCTGG - Intronic
1105482391 13:20790581-20790603 CTATTAAAATAAAAGGATGCAGG + Intronic
1105736600 13:23278128-23278150 CTGTAAAAGTAAGTTGAGGCTGG - Intronic
1106484815 13:30162778-30162800 CTATAAAGGAATATTGAGGCTGG + Intergenic
1106742936 13:32666239-32666261 CAATAAAAATAAAATCAGCCGGG - Intronic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1107471478 13:40695446-40695468 CGATAAAAACAATTAGAGGCCGG + Intergenic
1107854724 13:44603490-44603512 CTATAAAAATAAATTGAGGCCGG + Intergenic
1107907581 13:45075603-45075625 ATAAAATAATAAAATGAGGCTGG + Intergenic
1108017816 13:46094767-46094789 CAATAAAAATAAATCAAAGCTGG + Intronic
1108341465 13:49502001-49502023 TTCTAAAATTAAATTAAGGCAGG + Intronic
1108893484 13:55293750-55293772 CTATAAAAAAAACCTGAGACTGG - Intergenic
1108894030 13:55300123-55300145 ATAGAAAAATAAAATAAGGCTGG - Intergenic
1109147954 13:58806107-58806129 TTATAAAAATAAATTAAAGCAGG - Intergenic
1109238995 13:59860440-59860462 ATATAAATGAAAATTGAGGCCGG + Intronic
1109489393 13:63076251-63076273 CTATAGAAATAGATGGATGCTGG - Intergenic
1109752694 13:66717153-66717175 CTTTAAAAATACAATGAAGCTGG + Intronic
1109793765 13:67283258-67283280 ATATAAAAAGAAATTGCTGCTGG - Intergenic
1109820833 13:67651569-67651591 CTATAAAACAAAACTAAGGCTGG - Intergenic
1110264522 13:73522607-73522629 CTAAAAATATAAAATTAGGCAGG - Intergenic
1110367471 13:74702965-74702987 ATATAAATATAAAATGAGGCAGG + Intergenic
1111020515 13:82442574-82442596 ATATAAAAGTAAATTACGGCTGG - Intergenic
1111099379 13:83562645-83562667 TTATATAAAAAATTTGAGGCAGG + Intergenic
1111247962 13:85566624-85566646 ACATAAATATAAATTGATGCAGG - Intergenic
1111263785 13:85779130-85779152 CTATAAAGATAAAAGGAGGTTGG - Intergenic
1111298057 13:86309084-86309106 TTATAAATATAAATGTAGGCCGG + Intergenic
1111323435 13:86661013-86661035 CTACAACAATAATTTGAGACTGG - Intergenic
1111656439 13:91160177-91160199 CTATAAAAATAAATATATGTTGG + Intergenic
1112024910 13:95403146-95403168 TTATTAAAGAAAATTGAGGCCGG - Intergenic
1112554410 13:100453203-100453225 ATATGAAAACAAATGGAGGCCGG + Intronic
1112820215 13:103325111-103325133 ATACAAAAATAAATTGATGAGGG - Intergenic
1112887862 13:104195517-104195539 CTTTAAGAATAAATTAAGACTGG - Intergenic
1113546594 13:111155777-111155799 GTTTTAAAGTAAATTGAGGCTGG + Intronic
1113636307 13:111921282-111921304 CTATAAAAAGAAACTGAGAAAGG - Intergenic
1114431424 14:22664982-22665004 CTATAAAGAAAACCTGAGGCTGG + Intergenic
1114457223 14:22863815-22863837 ATACAAAAATTAATTAAGGCCGG - Intergenic
1114496041 14:23132948-23132970 TTTAAAAAAAAAATTGAGGCAGG + Intronic
1114899453 14:27038700-27038722 ATAGAAAAATAATTTGTGGCCGG + Intergenic
1114914012 14:27239435-27239457 CTATAAAAACTACTTGAGACTGG + Intergenic
1114956599 14:27827798-27827820 TTAAAAAAAAAAAGTGAGGCCGG - Intergenic
1115094920 14:29622697-29622719 GTAGAAAAATAAAATAAGGCCGG - Intronic
1115243480 14:31271986-31272008 CTATCTAAATTAACTGAGGCCGG + Intergenic
1115264303 14:31485337-31485359 CTATAAAAATCATTTCTGGCCGG + Intronic
1115415193 14:33124148-33124170 CTATAAAACTTCATAGAGGCTGG - Intronic
1115436689 14:33382924-33382946 CTACAAAAATAAAATGAGCCAGG + Intronic
1115655423 14:35439116-35439138 TTATAAAAAGAAGTAGAGGCTGG - Intergenic
1115836390 14:37409489-37409511 CCAAAAAAATAATTTGTGGCTGG + Intronic
1116818364 14:49604004-49604026 ATAAAAATATAAACTGAGGCTGG + Intronic
1117019789 14:51558170-51558192 TTTTAAAAATTAAATGAGGCCGG + Intronic
1117144732 14:52826357-52826379 CTATAAAATTAAGATGGGGCTGG + Intergenic
1117409968 14:55441302-55441324 TTATAAAAATAAAATTAGCCAGG - Intronic
1117905732 14:60583915-60583937 ATAAAAAAAGAAATTTAGGCTGG + Intergenic
1118127041 14:62917300-62917322 CTTTAAAGATAAATTGAGTAGGG - Intronic
1118334857 14:64844219-64844241 CTATAATAATAAAGACAGGCTGG - Intronic
1119067840 14:71548598-71548620 GTATAAAAATGAAATGAGGCCGG + Intronic
1119291823 14:73501419-73501441 CTCTAAAAATAATTTAAGGCCGG - Intronic
1119311911 14:73654460-73654482 CAATAAAGACAAATTGGGGCTGG + Intronic
1119324470 14:73751600-73751622 CTTTAAAAATAAAGCCAGGCCGG + Intronic
1119331149 14:73794906-73794928 CTAAAAAAATTAGCTGAGGCAGG - Intergenic
1119340778 14:73875638-73875660 CTATAAATATCAACTCAGGCCGG - Intronic
1119346693 14:73930895-73930917 ATATAAAAACAAAATGAGGCTGG - Intronic
1119371150 14:74144421-74144443 GTTTAAAAATAATTTGAGGCTGG - Intronic
1119468497 14:74878479-74878501 TTATGAATATAAATTGTGGCAGG - Intergenic
1119837751 14:77765936-77765958 ATTTGAAAGTAAATTGAGGCTGG - Intronic
1120407477 14:84106840-84106862 AGATAAAAATAAATGGAGGCTGG + Intergenic
1120484971 14:85101871-85101893 TTAAAAAATTAACTTGAGGCTGG - Intergenic
1120534913 14:85682823-85682845 CTATAAATATAAATTCAGTGGGG - Intergenic
1120707887 14:87763153-87763175 CTATAAAAAAAATCTGAGACTGG + Intergenic
1120804891 14:88736815-88736837 CTATAAAAAAAAATTAGGGAAGG - Intronic
1120857417 14:89224832-89224854 CTATAAAAAGAACTTAAGGACGG + Intronic
1121127130 14:91415423-91415445 TTATTAAAATAAAAGGAGGCCGG + Intronic
1121642177 14:95492842-95492864 CTTTAAAAAAAAATAGAGCCAGG - Intergenic
1121767377 14:96499652-96499674 TTTTAAAAATAAAATGAGGCCGG - Intergenic
1121989918 14:98546841-98546863 TTATTAAAATTAATTGAAGCTGG + Intergenic
1122442575 14:101742342-101742364 CTATAAACATAATCTGAGGCTGG - Intergenic
1122492395 14:102127810-102127832 CTATAAAAATAAGGTTAGCCAGG - Intronic
1122535749 14:102460989-102461011 TAAAAAAAAAAAATTGAGGCTGG - Intronic
1122536865 14:102471111-102471133 CTAAAAATATAAAATTAGGCTGG - Intronic
1122971265 14:105153172-105153194 TTACAAAAATAAAGTGTGGCGGG - Intronic
1123046450 14:105519236-105519258 CTCAAAAAAAAAGTTGAGGCTGG + Intergenic
1123465097 15:20509200-20509222 CTCAAAAAATAAATAAAGGCTGG + Intergenic
1123653020 15:22491829-22491851 CTCAAAAAATAAATAAAGGCTGG - Intergenic
1123696486 15:22882506-22882528 CTAGAAAACTAAATCCAGGCTGG + Intronic
1123743441 15:23300692-23300714 CTCAAAAAATAAATAAAGGCTGG - Intergenic
1124275822 15:28325179-28325201 CTCAAAAAATAAATAAAGGCTGG + Intergenic
1124292311 15:28464273-28464295 CTCAAAAAATAAATAAAGGCTGG - Intergenic
1124306880 15:28586422-28586444 CTCAAAAAATAAATAAAGGCTGG - Intergenic
1125015059 15:34924725-34924747 TTAAAAATATCAATTGAGGCCGG - Intronic
1125379507 15:39072656-39072678 CATTAAAAATCAATTCAGGCTGG + Intergenic
1125461447 15:39910730-39910752 TTATAAAAATAAAATGTTGCAGG - Intronic
1125561768 15:40639287-40639309 CTAAAAAAAAAAATTTTGGCCGG + Intronic
1125672834 15:41486123-41486145 TTAAAAAAAAAAATAGAGGCCGG - Intergenic
1126077763 15:44929956-44929978 TTATTAAAATAAATAGAGACAGG + Intergenic
1126080771 15:44959013-44959035 TTATTAAAATAAATAGAGACAGG - Intronic
1126285073 15:47001019-47001041 CTAAAAAAATAAAATTAGCCAGG - Intergenic
1126297316 15:47154963-47154985 CTAGAAAAATAGATTGTGTCTGG + Intergenic
1126313179 15:47339571-47339593 CTATAAAGAAAAATTGGGCCGGG + Intronic
1126349161 15:47726775-47726797 AAATAAAAATAAATGCAGGCTGG + Intronic
1126764375 15:51998236-51998258 CTAAGAAAATAACTTTAGGCTGG - Intronic
1126767401 15:52022812-52022834 GTTTAAAAACAAACTGAGGCCGG + Intronic
1126785005 15:52170931-52170953 CTATAAAAAAAAAATTAGCCAGG + Intronic
1126792361 15:52232981-52233003 TATTAAAAATAAATAGAGGCCGG + Intronic
1127306425 15:57710194-57710216 CTGTGAAAATAGATTCAGGCAGG + Intronic
1127359716 15:58234635-58234657 CTTTAAAAAGAAATGTAGGCTGG + Intronic
1127602548 15:60552714-60552736 CTAAAAAAATCAATTGGGGCAGG + Intronic
1128001293 15:64194804-64194826 TTAGAAAAATATATTGTGGCTGG - Intronic
1128164225 15:65448374-65448396 TTTTAAAAATATATTTAGGCTGG + Intronic
1128276974 15:66361987-66362009 AAATAGAAAGAAATTGAGGCTGG + Intronic
1128825252 15:70709975-70709997 CTTTAAAAATCTAATGAGGCAGG + Intronic
1129353081 15:74968815-74968837 TTAAAAAAATAAAAGGAGGCTGG - Intronic
1129438903 15:75564805-75564827 ACATAAAAATAAATTTTGGCTGG + Intronic
1129442359 15:75590935-75590957 CTATAAAGATGATATGAGGCTGG + Intergenic
1129447766 15:75630827-75630849 CTAAAAAAATAAATTAGGCCAGG - Intergenic
1129626872 15:77210581-77210603 TTAAGAAAATAAATTCAGGCTGG + Intronic
1129798268 15:78394504-78394526 ATAAAAGAATAAATGGAGGCTGG + Intergenic
1129874797 15:78967004-78967026 CTTTTAAAAAAAAATGAGGCTGG + Intronic
1130094386 15:80845152-80845174 TTTCAAAAATATATTGAGGCCGG + Intronic
1130133541 15:81162881-81162903 ATAAAAAAATAATATGAGGCCGG + Intronic
1130215219 15:81961776-81961798 CTATAAACCTAAAAAGAGGCTGG + Intergenic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1130619475 15:85446970-85446992 TTAAAATAATAAATTTAGGCCGG + Intronic
1130627266 15:85528327-85528349 CTAAAAAAATTAAGTGAGGAGGG - Intronic
1131036398 15:89225186-89225208 TTGTAAAAATTAGTTGAGGCCGG - Intergenic
1131976541 15:97952247-97952269 TTAAAAAAGTAAATTTAGGCTGG + Intergenic
1132049089 15:98592134-98592156 CTTTTAAACCAAATTGAGGCGGG - Intergenic
1132253370 15:100351161-100351183 TTTTAAAAATAAATTGAGTGTGG - Intergenic
1132307904 15:100830918-100830940 CCAGAAAAATAAATTAAAGCAGG + Intergenic
1132620216 16:862559-862581 TTCATAAAATAAATTGAGGCTGG + Intronic
1132640010 16:973702-973724 TTAGAAAAGTAAAATGAGGCCGG + Intronic
1133469380 16:6059290-6059312 TTATAAAAATAAATTAAACCTGG + Intronic
1133557084 16:6915846-6915868 CTATAAAAAGGAATGAAGGCTGG - Intronic
1133604021 16:7368480-7368502 CTTTAAAAAAAAATTGGAGCCGG + Intronic
1133646109 16:7766243-7766265 TTAAAAAAATAAATTCAGGCTGG - Intergenic
1133930721 16:10229953-10229975 ATAAATAAATAAATCGAGGCAGG - Intergenic
1133941212 16:10310661-10310683 AAATAAAAATAAATCCAGGCCGG + Intergenic
1134227333 16:12401292-12401314 TTTTAAAAATTAATTGAGACTGG - Intronic
1134285837 16:12861486-12861508 CTTAAAAATTAAATTGAGGCTGG + Intergenic
1134432852 16:14227498-14227520 AAACAAAAAAAAATTGAGGCTGG - Intronic
1134482393 16:14630771-14630793 TTAAAAAAATAAAATTAGGCCGG + Intronic
1135033690 16:19059172-19059194 CTAGAAAAATAAAATATGGCCGG - Intronic
1135088389 16:19492727-19492749 CTAAAAAAATAAAATAAGGCTGG - Intronic
1135104989 16:19641361-19641383 CTCTAAAAATAAAAACAGGCCGG - Intronic
1135146157 16:19964503-19964525 CAATAAAAATAATTTCAGTCCGG - Intergenic
1135297642 16:21296586-21296608 CTTTAATAATAAAATGGGGCAGG + Intronic
1135518392 16:23154248-23154270 CTATATAAAATAATTTAGGCTGG - Intergenic
1135523937 16:23199016-23199038 CTTAAAAAAAAAATAGAGGCAGG - Intronic
1135617683 16:23926108-23926130 CTATAAAAATTAAATTAGCCAGG + Intronic
1135621354 16:23958597-23958619 GTATAATAATAAAAAGAGGCTGG - Intronic
1135866949 16:26112044-26112066 TTATAAATATAAATTGTGGCAGG - Intronic
1135988861 16:27204726-27204748 GTTTAAAAATAATTTAAGGCTGG + Intronic
1135990898 16:27218119-27218141 CTACAAAAATAAAATTAGCCAGG + Intronic
1136465469 16:30440502-30440524 CTATAAAGATCAAATGAGGCAGG - Intergenic
1136531361 16:30871779-30871801 CTATAAAACAAAATAGTGGCCGG - Intronic
1137333813 16:47528543-47528565 CGAAAAAAAAAAATTGAGCCTGG - Intronic
1137340649 16:47600846-47600868 CATTAAAAATCACTTGAGGCTGG + Intronic
1137417376 16:48296074-48296096 CTATAAAAAGAACTTGAGAAAGG - Exonic
1137452897 16:48593711-48593733 CTATTAAACTAAATTTAGGCTGG + Intronic
1137749673 16:50850266-50850288 CTATATATAAAAATTTAGGCCGG - Intergenic
1137910460 16:52373006-52373028 CTATAAACAAAATCTGAGGCTGG + Intergenic
1137994803 16:53198620-53198642 CTTTAAACAAATATTGAGGCCGG - Intronic
1138160344 16:54747405-54747427 TTTTAAAAATAACTTCAGGCTGG + Intergenic
1138394231 16:56691837-56691859 CAATAAAATTAAGCTGAGGCAGG - Intronic
1138440378 16:57030811-57030833 CTATTAAAAAAAATTCAGCCGGG + Intronic
1138587964 16:57984198-57984220 CTTTAAAAATTTTTTGAGGCCGG - Intronic
1138650441 16:58457559-58457581 CAACCAAAAAAAATTGAGGCAGG - Intergenic
1139083353 16:63553481-63553503 ATATAAAAATAAATTTAGACTGG + Intergenic
1139118409 16:63985624-63985646 CTATAAAAAATAATTGAGCATGG + Intergenic
1139577271 16:67849635-67849657 AAATAAAAATAAAATTAGGCCGG - Intronic
1139624041 16:68170787-68170809 CAATAAAAGAAAATCGAGGCCGG - Intronic
1139744079 16:69060312-69060334 ATATAAAAGTGAATGGAGGCTGG - Intronic
1140445215 16:75021789-75021811 GTATAAAAATAAATTAAATCCGG - Intronic
1140574368 16:76148336-76148358 CTAAAAAAAGAAAATAAGGCAGG + Intergenic
1140746234 16:77982858-77982880 CTTTAAAAATTAATTTGGGCTGG - Intergenic
1140754828 16:78057671-78057693 CTATAAATAAAAATTTAGGCAGG - Intronic
1140911322 16:79455719-79455741 CAATAAAAACAAATTAAGGCTGG + Intergenic
1140967646 16:79982778-79982800 GTATAAACTTAAATTGAAGCTGG - Intergenic
1141186236 16:81789583-81789605 ATAAAAGAATGAATTGAGGCCGG - Intronic
1141404458 16:83779695-83779717 CTAAAAAAATAAAGTTAGCCAGG + Intronic
1141655654 16:85414930-85414952 AAATAAAAATAAAATCAGGCTGG - Intergenic
1141778459 16:86140500-86140522 ATATAAAAATAAAAAGAGCCTGG - Intergenic
1141914941 16:87089265-87089287 TTAAAAAAAAAAATTGAGACAGG + Intronic
1141923810 16:87153782-87153804 CTGGAAAGGTAAATTGAGGCAGG - Intronic
1142068950 16:88078946-88078968 GTATAAACAAAAATTGAGGCCGG + Intronic
1142337231 16:89497339-89497361 AAATAAAATTAAATTGTGGCCGG + Intronic
1142689359 17:1595739-1595761 CTACAAAAATAATTAAAGGCCGG - Intronic
1143545788 17:7594422-7594444 CCATATAAAGAAAATGAGGCTGG - Intronic
1143630130 17:8134213-8134235 CTATAGAAATAAATTAAGCTTGG + Intergenic
1143656871 17:8299850-8299872 AAAAAAAAAAAAATTGAGGCCGG + Intergenic
1144093529 17:11879384-11879406 CTAAAAGAATACAGTGAGGCTGG - Intronic
1144428622 17:15170108-15170130 CAATAAAAACTAAGTGAGGCTGG + Intergenic
1144558410 17:16301863-16301885 CTAAAAAAAAAAAATTAGGCTGG - Intronic
1145073881 17:19835375-19835397 ATATAAAAACTAGTTGAGGCCGG - Intronic
1145953568 17:28838906-28838928 CAAAAAAAATAAAATAAGGCCGG + Intronic
1145957720 17:28866190-28866212 TTAAAAAAAGAAATTCAGGCCGG + Intergenic
1145977211 17:28991199-28991221 ATAAATAAATAAATGGAGGCTGG - Intronic
1146041575 17:29459571-29459593 CCATAAAAAAAGAATGAGGCCGG - Intronic
1146045484 17:29502267-29502289 CTAAAAAAATAAAATTAGCCTGG + Intronic
1146095115 17:29922650-29922672 AAATAAAAATGAAATGAGGCTGG + Intronic
1146123552 17:30215337-30215359 ATATAAAAATAATAAGAGGCTGG - Intronic
1146231703 17:31116970-31116992 TAATAAAAATAAAATGAGCCAGG - Intronic
1146334002 17:31953702-31953724 AAAAAAAAAAAAATTGAGGCTGG - Intronic
1146714781 17:35076289-35076311 ATTTAAGAGTAAATTGAGGCCGG - Intronic
1146783172 17:35694555-35694577 CTTTAAAAATACATTTAGGCTGG - Intronic
1146834863 17:36102626-36102648 CTATAAAAAAATATTTTGGCTGG - Intergenic
1147763492 17:42816807-42816829 CTAAAAAAATAAAATTAGCCAGG + Intronic
1147960126 17:44162211-44162233 CTCTAAAATTAAGCTGAGGCAGG - Exonic
1147981364 17:44276335-44276357 CTAAAAATATAAAATTAGGCTGG - Intergenic
1148221664 17:45866853-45866875 CCTTAAAAAAAAAGTGAGGCTGG - Intergenic
1148257291 17:46146535-46146557 CTATCACAAGAAGTTGAGGCCGG + Intronic
1148804347 17:50256920-50256942 CTTGCAAAAAAAATTGAGGCTGG + Intergenic
1148888940 17:50793845-50793867 CTCTAAAAAAAAAATCAGGCTGG + Intergenic
1149742437 17:59059379-59059401 GTAAATAAATAAATTGAGACAGG + Intronic
1149744014 17:59077082-59077104 AAATAAAAATAAATAAAGGCCGG - Intronic
1149745419 17:59092987-59093009 CTAAAAATACAAATTGAGCCAGG + Intronic
1149771382 17:59324549-59324571 TTTTAAAAATAAATTCTGGCTGG - Intergenic
1149822516 17:59793312-59793334 TTAAAAAAATTAATAGAGGCTGG - Intronic
1150066712 17:62116218-62116240 ATAAAAAAATAAAATAAGGCTGG + Intergenic
1150597752 17:66621903-66621925 CTTTAAAAATAAGTTGAGGCTGG + Intronic
1150707766 17:67503090-67503112 CTTTAAAAAGAAATAGAGCCTGG - Intronic
1150781656 17:68127908-68127930 TTATGAAAATAAATTGAGAAAGG - Intergenic
1151634753 17:75338359-75338381 CTTTAAAAATTATTTGTGGCCGG - Intronic
1151723599 17:75872456-75872478 CTTTAAAAAAATATTGAGGCTGG - Intergenic
1151761888 17:76109024-76109046 CTAAAAAAATAAAATAAGGCTGG + Intronic
1151831659 17:76556139-76556161 AAATAAAAATAAAAAGAGGCTGG + Intergenic
1152060055 17:78065932-78065954 ATATTAAAATTAATTGTGGCTGG + Intronic
1152182778 17:78834723-78834745 CTACAAAAACAAATCAAGGCCGG - Intronic
1152479902 17:80543794-80543816 CTATAAAACCAAATGTAGGCAGG - Intergenic
1153414802 18:4834964-4834986 TTGAAAAAATAAAATGAGGCCGG - Intergenic
1153482306 18:5559267-5559289 CTTTACAAATAAATGGAGGAGGG + Intronic
1153906245 18:9663985-9664007 TTAAAAAAGTAAATCGAGGCCGG + Intergenic
1154092338 18:11377507-11377529 ATCTTAAAATAATTTGAGGCCGG + Intergenic
1154319447 18:13334528-13334550 ATATAAAGGTTAATTGAGGCCGG - Intronic
1155002585 18:21701498-21701520 TTAAAAAAATAATTTTAGGCTGG - Intronic
1155181002 18:23346414-23346436 CTATAAAAATAGTTGAAGGCAGG - Intronic
1155202846 18:23532597-23532619 CTACAAAAATAAAATTAGCCAGG - Intronic
1155391701 18:25345130-25345152 CTTTAAAAATAGAGGGAGGCAGG + Intronic
1155460133 18:26070148-26070170 CTATAAAAATAAATTAAAAATGG + Intronic
1155798448 18:30070172-30070194 CTTAAAAAATAAATTCAGCCAGG + Intergenic
1155947530 18:31872713-31872735 ATATAAAATTATATTGTGGCCGG - Intronic
1156064449 18:33122685-33122707 CTTTAAAAATGAATTAAGTCTGG - Intronic
1156345933 18:36257239-36257261 CTATAAAGATGAATGGAAGCTGG - Intronic
1156637113 18:39044775-39044797 ATATAAAAACAAGTTGAGGCCGG - Intergenic
1156840848 18:41608017-41608039 ATTTAAAAATAAAATTAGGCCGG + Intergenic
1157043186 18:44063482-44063504 CTGGAAGAATAAAATGAGGCTGG + Intergenic
1157517164 18:48318965-48318987 CTATTAAAATAAAATGCAGCTGG - Intronic
1157545893 18:48546209-48546231 CTATAAAAATGAAGTATGGCAGG - Intronic
1157571875 18:48717888-48717910 CAATAAAAATAAAATTAGTCAGG - Intronic
1157627776 18:49065656-49065678 TTAAAAAAAAAAATTGAGGCCGG - Intronic
1157659519 18:49427784-49427806 CAATAAAAAGGAATGGAGGCTGG + Intronic
1157836087 18:50904577-50904599 CTAAAAATATAAAATTAGGCTGG - Intronic
1158098279 18:53800247-53800269 CTCTAAAGATAAATTGAGGATGG + Intergenic
1158270317 18:55706181-55706203 ATATAAAGAGTAATTGAGGCTGG - Intergenic
1158276209 18:55770657-55770679 CTTTAAAAAAAAATTTAGGCCGG + Intergenic
1158614771 18:58976810-58976832 ATATAAAAATCAACTGAGGCTGG - Intronic
1158657370 18:59350789-59350811 CTTTAAAAAAAAATTGGGGCCGG - Intronic
1158931898 18:62330908-62330930 GTAAAAAAATAAAATAAGGCCGG + Intronic
1158972493 18:62681073-62681095 CTATAAATGTAAAATGGGGCTGG - Intergenic
1159082534 18:63752053-63752075 TTATAATAATAAGTTGAGACAGG - Intergenic
1159208688 18:65287031-65287053 CTAAAATAAAAAATTAAGGCCGG + Intergenic
1159275668 18:66218413-66218435 CTGTAGATATAAATTGATGCAGG - Intergenic
1159908392 18:74119489-74119511 CTATGAAGAAAAATTGAGGCAGG + Intronic
1159970770 18:74649192-74649214 CTATAAGAATATATTGAGCTGGG + Intronic
1160200318 18:76790394-76790416 TATTACAAATAAATTGAGGCTGG + Intergenic
1160364941 18:78315828-78315850 ATAAAAAAATAAATGGAAGCTGG + Intergenic
1160736718 19:666103-666125 CTACAAAAATAGAATTAGGCCGG + Intergenic
1160743835 19:700923-700945 GTTAAAAAATAAAGTGAGGCTGG - Intergenic
1160907513 19:1458434-1458456 ATATAAAAAGTAATTGAGGCCGG + Intronic
1161246884 19:3257770-3257792 AAATAAAAAAAAATGGAGGCTGG - Intronic
1161676721 19:5654862-5654884 TTCTTAAAATAATTTGAGGCTGG - Intronic
1161721619 19:5905716-5905738 CAAAAATAATAAATTTAGGCCGG - Intronic
1161823834 19:6548648-6548670 AGACAAAAATAAATTTAGGCTGG - Intergenic
1161829517 19:6592203-6592225 CTAAAAATATTAATTTAGGCCGG - Intronic
1161902729 19:7131640-7131662 TTATATAAGTAAATTGTGGCTGG - Intronic
1162048141 19:8015091-8015113 AAATAAAAATAAAATAAGGCCGG + Intronic
1162077591 19:8198484-8198506 AATTAAAAATAATTTGAGGCCGG - Intronic
1162209716 19:9081651-9081673 CTAAAAAAATAAAGTAAGCCTGG - Intergenic
1162270675 19:9612512-9612534 CTATAAAAATAAATTGAGGCTGG - Intronic
1162275903 19:9654741-9654763 CTATAAAAATAAATTGAGGCCGG - Intronic
1162366068 19:10250453-10250475 CTACAAAAAAAAAATTAGGCCGG + Intergenic
1162429026 19:10615862-10615884 CTGTAAAGATGAAATGAGGCGGG + Intronic
1162436888 19:10666039-10666061 TCATAAAAATAAAGTGAGGCAGG - Intronic
1162505045 19:11078666-11078688 CTAAAAAAAAAAAAAGAGGCCGG - Intergenic
1162611561 19:11758884-11758906 TTATAAAATTACATTGAGGCCGG + Intergenic
1162942960 19:14024804-14024826 AAAAAAAAAAAAATTGAGGCCGG - Intergenic
1163017752 19:14467241-14467263 CTAAAAAAAAAAATTCAGGTTGG + Intronic
1163399113 19:17081321-17081343 CTAAAAATGTAAGTTGAGGCCGG - Intronic
1163524912 19:17814915-17814937 TTTCAAAAATAAAATGAGGCTGG + Intergenic
1164038150 19:21471703-21471725 TTTTAAAGAAAAATTGAGGCCGG - Intronic
1164262656 19:23581574-23581596 CTAAAAAATTACATTGAAGCTGG - Intronic
1164746144 19:30615239-30615261 CTAAAAGCAAAAATTGAGGCCGG - Intronic
1164839791 19:31384245-31384267 CTGTAAAAGCAATTTGAGGCCGG - Intergenic
1164858531 19:31544214-31544236 CTATAAAAAATATCTGAGGCTGG + Intergenic
1165050491 19:33138506-33138528 CTAAAAAAATAAAATTAGCCAGG - Intronic
1165368396 19:35385062-35385084 TTAAAAAATTAACTTGAGGCCGG + Intergenic
1165544351 19:36521751-36521773 CTAAAAAAATAAAATAAGGCCGG + Intronic
1165546112 19:36537620-36537642 GTAAAAAAATTAATTTAGGCCGG - Intronic
1165575914 19:36817661-36817683 CAAAAAAAAAAAATAGAGGCAGG + Exonic
1165859813 19:38902364-38902386 CAAAAGAAATAAAATGAGGCCGG - Intronic
1165863781 19:38923516-38923538 CTATAAAGAAAACCTGAGGCCGG - Intronic
1166018695 19:40004563-40004585 CTTTAAAAATTAATTTAGGCTGG - Intronic
1166248689 19:41550472-41550494 GAATAATGATAAATTGAGGCCGG + Intronic
1166517114 19:43455372-43455394 TTATAAAAATAAAATGAGCTAGG - Intergenic
1166569777 19:43786591-43786613 ATACAAAAATAAAGTTAGGCCGG - Intergenic
1166847810 19:45740452-45740474 CTATTAAAACAAATGAAGGCCGG + Intronic
1167449456 19:49558404-49558426 ATAAAAAAAAAAATTGAGCCGGG - Intronic
1167736812 19:51299658-51299680 CTTTAAATATATACTGAGGCTGG + Intergenic
1167982552 19:53287086-53287108 CTAAAAAAAAATATTGTGGCTGG - Intergenic
1168043634 19:53778479-53778501 AAATAAAAATAAAATTAGGCTGG - Intergenic
1168127698 19:54295373-54295395 CAATAAAAATAAAAATAGGCCGG - Intergenic
1168142551 19:54398776-54398798 ATATAGAAATAAAGAGAGGCCGG - Intergenic
1168190029 19:54731300-54731322 CTCAAAAAATAAAATGAGGTCGG - Intronic
1168210277 19:54885100-54885122 ATTTAAAAAAAAATTTAGGCCGG - Intronic
1168284815 19:55325753-55325775 ATATAAAAATAAAAATAGGCCGG - Intronic
1168447825 19:56437398-56437420 CTATAAAAATAAAATGGGGCTGG - Intergenic
1168674288 19:58265750-58265772 CTAAAAAAATAAATTTAGCCAGG - Intronic
1168703084 19:58453117-58453139 ATAAATAAATAAATTGAGGAGGG + Intronic
925143014 2:1562984-1563006 CAATAAAAATAAATTCTGGCTGG - Intergenic
925390110 2:3488805-3488827 CTATAATAATAAAGGCAGGCAGG + Intergenic
925955855 2:8963237-8963259 CAAAAAAAAAAAATTGAGGCGGG + Intronic
926390884 2:12391427-12391449 CTATAAAAAGAGAGTGAGGAGGG - Intergenic
927454192 2:23235286-23235308 ATTTAAAAATAACATGAGGCTGG - Intergenic
928531390 2:32196016-32196038 CTTTAAAAAAAAATGAAGGCTGG + Intronic
928542793 2:32299168-32299190 CTGTAAGAATAAATTCTGGCTGG - Intronic
928691045 2:33798972-33798994 CTTTAAAAAACAAATGAGGCCGG + Intergenic
928967632 2:36993019-36993041 ATTTAAAAATAAAATGGGGCCGG - Intronic
929283660 2:40111317-40111339 CTATATAAAGAAATAGAGGTTGG + Intronic
929325330 2:40603689-40603711 ATATAAAAATAAATGTAGGCTGG + Intronic
929362053 2:41103683-41103705 TGATAGAAATAAATTTAGGCTGG + Intergenic
929540220 2:42813539-42813561 TGATAAAAATCAAGTGAGGCAGG + Intergenic
929697162 2:44127969-44127991 CTAAAAAAACAAAGAGAGGCCGG + Intergenic
929798015 2:45075101-45075123 CCATAGGAACAAATTGAGGCAGG - Intergenic
930023706 2:47016900-47016922 TTAAAAAAAAAATTTGAGGCCGG + Intronic
930169660 2:48238114-48238136 CTTTAATAATAAATTTTGGCCGG - Intergenic
930592347 2:53343038-53343060 CTATTCAAAAAAATTGAGGAGGG - Intergenic
930645065 2:53897468-53897490 CTTTAAAAATACCCTGAGGCTGG - Intronic
930761546 2:55043910-55043932 AAATAAAAATATATTTAGGCTGG + Intronic
930966828 2:57338544-57338566 CTATAATAGAAAATTGAGGCTGG - Intergenic
931273061 2:60719760-60719782 TTAAAAAAATAAATTCAGGCCGG + Intergenic
931311711 2:61087553-61087575 CTAAAAAAATAAAATAAGGCCGG + Intronic
931410529 2:62025847-62025869 CTATAAAAAAAAAATTAGCCGGG - Intronic
931434972 2:62238187-62238209 CTAAAAAAAAAAGTTCAGGCAGG + Intergenic
932030235 2:68176496-68176518 ATAAAAAAATAATTTGAGGTGGG - Intronic
932149068 2:69352747-69352769 ATGTAAAAAAAATTTGAGGCTGG + Intronic
932236142 2:70122670-70122692 CTACAAAAATAAAATTAGCCTGG - Intergenic
932482378 2:72052903-72052925 CTATAAAAATAAAAAGAGTATGG - Intergenic
932704866 2:74016069-74016091 CTTTAAAAAAAAATTCAGGCTGG + Intronic
932941225 2:76169007-76169029 TTATAAAAATATAATGAGTCTGG + Intergenic
933051171 2:77604371-77604393 GCATAAAAAGAAATTCAGGCCGG - Intergenic
933670166 2:84999445-84999467 TTATAAAAAATAAATGAGGCCGG - Intronic
934080820 2:88466382-88466404 TTATAAAAATTAAATGAGACAGG - Intergenic
934611746 2:95743480-95743502 CGATTAAAATAAATTGACTCAGG + Intergenic
935616949 2:105095791-105095813 ATATAAAAGAAAATTTAGGCTGG - Intronic
935870810 2:107447067-107447089 CTAGAAAAAAAAACAGAGGCTGG + Intergenic
936117889 2:109716544-109716566 CTCAAAAAATAAAATAAGGCTGG - Intergenic
936545081 2:113385096-113385118 CGATTAAAATAAATTGACTCAGG + Intergenic
936554699 2:113484959-113484981 ATGTAAAAATACATTGAGGCCGG - Intronic
936608901 2:113982498-113982520 AAATAATAATAAAATGAGGCTGG - Intergenic
936828144 2:116606321-116606343 CTATAAAAATTAAATGATGATGG - Intergenic
936906822 2:117545894-117545916 ATATAAAAAAAAAATGAAGCTGG - Intergenic
937027772 2:118713421-118713443 CGAGAAAAATAAATTGAGGCAGG + Intergenic
937166052 2:119818570-119818592 CTTTAAAAACAAACAGAGGCTGG - Intronic
937306693 2:120876043-120876065 TTACAAAAATAAATGCAGGCCGG + Intronic
937467824 2:122150270-122150292 CTTTAAAAATAAGTTGTGTCAGG - Intergenic
937524720 2:122754455-122754477 CAATAACAATAAAATAAGGCAGG + Intergenic
937690990 2:124754847-124754869 CTAAAAAAAAAAATGTAGGCTGG - Intronic
937693676 2:124784135-124784157 GCATAAAAATAAAGTAAGGCAGG + Intronic
938344854 2:130559860-130559882 ATATAAAAATAATTAGAAGCAGG + Intergenic
938344979 2:130560860-130560882 ATATAAAAATAATTAGAAGCAGG - Intergenic
938957191 2:136309661-136309683 GAATAAAAATGAAATGAGGCTGG + Intergenic
939391930 2:141579414-141579436 CTTTCAAAAAAAATAGAGGCTGG - Intronic
939738075 2:145874383-145874405 CCTTAAAAATAATTTCAGGCAGG + Intergenic
939854493 2:147341823-147341845 CTAAAAATACAAATTTAGGCGGG - Intergenic
940124025 2:150303750-150303772 CTATAGAGATAATTTGAGGCTGG + Intergenic
940449278 2:153817879-153817901 CCATGAAAATAAATTAAGGAGGG + Intergenic
940616979 2:156060944-156060966 CTGTAAGAACAAATTGAAGCTGG + Intergenic
940967613 2:159857443-159857465 GCTTAAAAATAATTTGAGGCTGG + Intronic
940975296 2:159936247-159936269 CTTAAAAAATAATTTTAGGCTGG - Intronic
941020104 2:160398640-160398662 CTATTAAAATAAATTGGAGAGGG - Intronic
941174584 2:162180976-162180998 CTTAAATAATAAATGGAGGCCGG + Intronic
941226443 2:162855924-162855946 ATATAAAAATTAATTGAAGATGG - Intergenic
941266658 2:163371453-163371475 TTATAAAAATAAAAAGAGGCTGG + Intergenic
941720136 2:168803929-168803951 CTATACAAAAACATTGAGGTAGG - Intronic
941910928 2:170763911-170763933 CTAAAAAAAAAAAAAGAGGCCGG + Intergenic
942005343 2:171694336-171694358 CTATAAAGAAATACTGAGGCTGG + Intronic
942409767 2:175696666-175696688 CTAGATAAATAAATTCAGGCAGG + Intergenic
942482805 2:176407185-176407207 TTTTAAGAATAAAGTGAGGCAGG + Intergenic
942762237 2:179412893-179412915 CTTTAAAAATATTTTTAGGCCGG + Intergenic
942854356 2:180527871-180527893 CTACAAAAATTAATTGAAGATGG - Intergenic
942877121 2:180814321-180814343 CTTTAAAAAGAAATAGGGGCCGG + Intergenic
943371317 2:187019997-187020019 CTATAAAAATGAATTTGGACTGG + Intergenic
943792851 2:191954181-191954203 CTATAAAAATGAATGCAGGCCGG - Intronic
944008632 2:194943231-194943253 CTATAAAAATAAAATAAGGCAGG - Intergenic
944122272 2:196252716-196252738 CTATAAAGAAAACCTGAGGCTGG - Intronic
944139434 2:196439084-196439106 ATAGGTAAATAAATTGAGGCAGG - Intronic
944178824 2:196864093-196864115 CTTAAAAAGTAATTTGAGGCCGG + Intronic
944709714 2:202324745-202324767 ATAAAAAGATAATTTGAGGCTGG - Intergenic
944725795 2:202470045-202470067 TTAAGAAAATAAGTTGAGGCTGG + Intronic
944758236 2:202786248-202786270 GTTTAAAAAATAATTGAGGCCGG + Intronic
944766339 2:202868668-202868690 CTATATAAAACAATTAAGGCCGG + Intronic
944789529 2:203110372-203110394 CTAAAAAATTTAAATGAGGCTGG + Intronic
944805331 2:203275593-203275615 CTATAAAAATTATTTGAGCACGG - Intronic
944850244 2:203711893-203711915 ATATAAAAAGAAATATAGGCCGG + Intronic
945047446 2:205794404-205794426 ATATTTAAATAATTTGAGGCCGG - Intronic
945093483 2:206197828-206197850 CTACAAAAAGAAAGTGAGACTGG - Intronic
945308627 2:208284555-208284577 TTATAAAAAAAAGTTAAGGCCGG - Intronic
945658077 2:212650099-212650121 CTATATAACTAAATTAATGCAGG + Intergenic
945948833 2:216019799-216019821 CAATAAAAATAGTTTGAGGCTGG - Intronic
946277346 2:218641538-218641560 TTAAAAAAAAAAATTGAGGCTGG - Intronic
947426069 2:229984051-229984073 TTATAAAAATAAAATCAGGTTGG + Intronic
948243989 2:236462508-236462530 CTAAAAATATAAAATTAGGCTGG + Intronic
948452697 2:238086856-238086878 CTAAAAATATAAAATGAGCCGGG + Intronic
948546588 2:238735795-238735817 CTATAAATATCAATTAGGGCTGG + Intergenic
948585064 2:239014353-239014375 TTATAAAAAGAAATTAAAGCAGG - Intergenic
948914535 2:241026310-241026332 CTAGAAAAATAAAAACAGGCTGG - Intronic
949060976 2:241957144-241957166 CTATAAAGAAATACTGAGGCTGG + Intergenic
1169032274 20:2418778-2418800 CTTTAAAAATATATTGAGGCCGG + Intronic
1169108334 20:3016449-3016471 CATTAAAAAGTAATTGAGGCCGG + Intronic
1170030209 20:11936311-11936333 CTAAATAAATAAAATGAGCCAGG + Intergenic
1170654359 20:18272238-18272260 TTACAAAAATGAATTCAGGCTGG - Intergenic
1170994822 20:21342910-21342932 CAATAAAAATAAATACAGGAAGG - Intronic
1171045298 20:21805024-21805046 CCATAAAAATGAATTTTGGCAGG + Intergenic
1171425493 20:25046235-25046257 CTCTAAAAATAAACAGGGGCCGG - Intronic
1172083654 20:32361341-32361363 CTCTAAAAAAATAATGAGGCTGG + Intronic
1172213882 20:33220395-33220417 CTAAAAAAAAAAAATAAGGCTGG + Intronic
1172246681 20:33450242-33450264 CTTTAAAAACAAAAAGAGGCTGG - Intergenic
1172874409 20:38155642-38155664 TTATAGAAACAAAATGAGGCCGG - Intronic
1173304694 20:41837080-41837102 CCATAAAAACAAATGGAGCCCGG - Intergenic
1173521226 20:43701722-43701744 CTATAAAAATATCTGCAGGCTGG + Intronic
1173913202 20:46685832-46685854 CTAAGAAAAGAAACTGAGGCTGG + Exonic
1174228630 20:49025675-49025697 ATAAAAAGACAAATTGAGGCCGG + Intronic
1174247419 20:49192048-49192070 CTCAAAAAACAAAATGAGGCTGG + Intergenic
1174405394 20:50299566-50299588 TTAAAAAAAAAAATGGAGGCCGG + Intergenic
1174621205 20:51875972-51875994 CTAAAAAAATAAAATGGGCCGGG + Intergenic
1174841615 20:53906520-53906542 ATTTGAAAATAAATTCAGGCTGG + Intergenic
1175024245 20:55884897-55884919 TTCTAAAAATAAAATCAGGCCGG + Intergenic
1175654314 20:60755443-60755465 GTATAGAAATGAATTGTGGCTGG + Intergenic
1176225265 20:63994452-63994474 TTAGAAAAATCAATTTAGGCCGG - Intronic
1176275684 20:64266551-64266573 CTAAAAAAATAAAATTAGGCCGG - Intronic
1177149436 21:17440050-17440072 ATAGAAATATAAAGTGAGGCTGG + Intronic
1178163328 21:29943881-29943903 TTATAAAAATAAACTGATACGGG - Intergenic
1178181633 21:30168575-30168597 ATATAAAAATAATCTGAGGCTGG + Intergenic
1178314389 21:31557269-31557291 TAATAAAAAGAAATTGGGGCTGG + Intronic
1178377673 21:32081098-32081120 ATTGAAAAATACATTGAGGCCGG - Intergenic
1178419054 21:32428997-32429019 AAATAAAAATAAATTGAGGAAGG - Intronic
1178589862 21:33900556-33900578 TTTTAAAAATAAGTTAAGGCTGG + Intronic
1179526857 21:41984440-41984462 CTGTAAAAATAAATTAATTCAGG + Intergenic
1179660593 21:42872311-42872333 CTTTGAAAATAAGATGAGGCTGG + Intronic
1179813833 21:43890411-43890433 CTTAAAAAAAAAATTGAGACCGG - Intronic
1180887278 22:19255611-19255633 ATATAAAAAAGAATTCAGGCCGG + Intronic
1180889125 22:19272766-19272788 ATATTAAATTAAATTAAGGCCGG - Intronic
1180970658 22:19813386-19813408 CTTCAAAAATAAAATAAGGCTGG + Intronic
1181095563 22:20503047-20503069 CAATAAAAATGAATTGCGGCTGG + Intronic
1182305989 22:29368761-29368783 AAAAAAAAAAAAATTGAGGCCGG + Intronic
1182313254 22:29424667-29424689 AAAAAAAAAAAAATTGAGGCTGG + Intergenic
1182380045 22:29880465-29880487 ATATAAAAATAAAAAGAGGCCGG + Intergenic
1182565215 22:31193495-31193517 CTATAAAAACACATTTTGGCCGG + Intronic
1182590323 22:31374244-31374266 TTAAAAAAATAAATTTAGGCTGG - Intergenic
1183173972 22:36208823-36208845 CTAAGAGAATAAATTCAGGCAGG + Intergenic
1183611431 22:38909346-38909368 CCATAAAAAGGAATGGAGGCCGG - Intergenic
1183686904 22:39366347-39366369 CTTTCAAAATATATTCAGGCCGG + Intronic
1183712002 22:39510421-39510443 AGATAAAAATAAATTGAGCATGG - Intronic
1183851056 22:40588321-40588343 TTACAAAAAAAAGTTGAGGCTGG - Intronic
1183906796 22:41047578-41047600 CTAAAAAAATAAAAATAGGCCGG - Intergenic
1183988622 22:41583450-41583472 CCAAAAAAATAGATAGAGGCTGG - Intronic
1184263254 22:43331959-43331981 CTAAAAAAAGACAGTGAGGCTGG + Intronic
1184299456 22:43547607-43547629 CCATAAAAATAAGCTGAGGGTGG + Intronic
1184463424 22:44654389-44654411 CTATAAAAATAAAATAGGCCAGG + Intergenic
1184463472 22:44654717-44654739 AAATAAAATAAAATTGAGGCAGG + Intergenic
1184571297 22:45326528-45326550 AAATAAAAAAAAATTTAGGCCGG + Intronic
1184610435 22:45599754-45599776 CTAAAAATATAAAATGAGCCAGG + Intronic
1184944364 22:47792339-47792361 CTTTAAAAATTACTTAAGGCTGG - Intergenic
949418648 3:3841001-3841023 ACATAAAAATTAGTTGAGGCTGG + Intronic
949913992 3:8942460-8942482 CTATAAAGTAAACTTGAGGCTGG - Intronic
949967654 3:9372277-9372299 CTGAAAAAATAAAATAAGGCTGG + Intronic
950036098 3:9886946-9886968 CTCTAAAAATAAAATTAGCCAGG - Intergenic
950312821 3:11974120-11974142 CTATAAGAAGAACTTGAGGCTGG + Intergenic
951480211 3:23152827-23152849 AAAAAAAAAAAAATTGAGGCAGG + Intergenic
951561388 3:23970234-23970256 CTTCTAAAATAAATTAAGGCAGG + Intronic
951585599 3:24211965-24211987 ATAGAAAAGGAAATTGAGGCTGG + Intronic
951716333 3:25651568-25651590 CTTTAAATATAAATTGGGCCAGG + Intronic
951885351 3:27518919-27518941 TTAAAAAAAAAAATAGAGGCCGG + Intergenic
952339184 3:32431352-32431374 TTATAGAAATTAATTCAGGCAGG - Intronic
952356114 3:32585617-32585639 TTATAAATAAAAATTGAGGTGGG - Intergenic
952429902 3:33213243-33213265 CTATAAAAAAAAAATTAGCCAGG + Intronic
952521969 3:34170008-34170030 ATATAAAAAAAAATTTAGCCAGG - Intergenic
952940146 3:38437773-38437795 GTATAAAAATAAAAATAGGCCGG + Intergenic
953689347 3:45104755-45104777 ATATAAAAAACATTTGAGGCTGG + Intronic
953737999 3:45512936-45512958 ATAAGAAAATAAATTCAGGCTGG - Intronic
953950909 3:47189367-47189389 GTAAAAAAATAAAATAAGGCCGG + Intergenic
954009660 3:47624750-47624772 ATTCAAAAATAAATTGAGGCTGG + Intronic
954183528 3:48899698-48899720 CTAAAAAAAAAAAGTTAGGCCGG + Intergenic
954454376 3:50589598-50589620 CTAAAAAAATAATTTTAGGCCGG + Intergenic
954482614 3:50815117-50815139 CTATAAAAATAAAATGAGGCTGG - Intronic
954528808 3:51299572-51299594 ATATAAAAATTAATTGAAGATGG - Intronic
955191743 3:56768048-56768070 ATATATATATATATTGAGGCTGG - Intronic
955313652 3:57915993-57916015 CTAAAAATATAAAATGAGCCAGG + Intronic
955876979 3:63501180-63501202 TTATGAAAATTAAATGAGGCTGG + Intronic
955914686 3:63894819-63894841 CAATAAAAATATGTTGAGGCTGG - Intronic
956191749 3:66614628-66614650 CTATAATAATAAATTCAGACTGG - Intergenic
956394924 3:68815149-68815171 ATATAAAAATTAATTCAGGATGG + Intronic
956479267 3:69657250-69657272 TTATAAAAATTTATTGGGGCTGG - Intergenic
956493109 3:69795427-69795449 ATTTAAAAATAAATCTAGGCTGG + Intronic
956803292 3:72783339-72783361 GTATAAAAATAAATTGGGCAAGG - Intronic
956825782 3:72996257-72996279 ATATAAAAATAAATACAGGCCGG - Intronic
957057390 3:75454363-75454385 CTTTAGAAATGAATTAAGGCCGG + Intergenic
957822422 3:85395135-85395157 CAATAAAGATAAATTTAGCCAGG + Intronic
957891955 3:86370844-86370866 TTATAAAAATCAGTGGAGGCTGG - Intergenic
957987195 3:87587647-87587669 CTACAAAAATTAATTCAGGATGG + Intergenic
958748860 3:98170932-98170954 CTAAAAAAAGAAATTGAAGGGGG - Intronic
958870354 3:99551357-99551379 CTATAAATAAAAAATTAGGCAGG + Intergenic
960007201 3:112792420-112792442 CTACAAAAATAAAATTAGCCTGG + Intronic
960421007 3:117445150-117445172 CTGTAAAAATAGATTAAGGATGG - Intergenic
960755854 3:121011372-121011394 CTATAAAAATAAAGGGTTGCAGG - Intronic
960844238 3:121992432-121992454 CTTTAAAAATTATTTGGGGCTGG - Intronic
960878809 3:122323915-122323937 ATATAAAAATAATTGGAGGCTGG - Intergenic
961025802 3:123556138-123556160 TCTAAAAAATAAATTGAGGCCGG + Intronic
961439477 3:126944387-126944409 TTCTATAAATAAATTGAGGTAGG - Intronic
961654665 3:128434630-128434652 CTTTAAAGATAAATTCAGCCTGG - Intergenic
961879262 3:130049244-130049266 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
961884908 3:130090370-130090392 AAATAAAAATAAATTGAGGAAGG + Intronic
961989813 3:131176371-131176393 TTATAAAGATAAATTGATGGTGG + Intronic
962195966 3:133363700-133363722 CTATAAAAATAATAACAGGCCGG - Intronic
962371691 3:134825943-134825965 CTATAAAAGGCAATTGAGACTGG + Intronic
962506083 3:136047742-136047764 ATACAAAAAAAAATTTAGGCAGG + Intronic
962560607 3:136602552-136602574 CTATTAAAGTATAATGAGGCCGG + Intronic
962565802 3:136658024-136658046 ATTTAAAAACAAAATGAGGCTGG + Intronic
963039885 3:141061894-141061916 CTAAAAAAATAAAATTAGCCAGG - Intronic
963126737 3:141823412-141823434 TTAAAACAAAAAATTGAGGCTGG - Intergenic
963138646 3:141930106-141930128 CTTTAAAGAAATATTGAGGCCGG + Intergenic
963398198 3:144760094-144760116 CTATGAAAAAAAAAGGAGGCTGG - Intergenic
963782964 3:149505743-149505765 CTAAAAAAGTAATTTAAGGCTGG + Intergenic
964351416 3:155806834-155806856 ATAAAAATATATATTGAGGCCGG + Intergenic
964592862 3:158385174-158385196 ATACAAAAATAAATTGTGCCAGG + Intronic
964858650 3:161175068-161175090 ATAAAAAAACAAAATGAGGCTGG - Intronic
965388621 3:168076395-168076417 CTAAAAAAATAAATCCTGGCCGG + Intronic
965435662 3:168647963-168647985 CTATTTAAATAAATCTAGGCTGG + Intergenic
965568207 3:170144028-170144050 CTGTAAGAATATATCGAGGCCGG + Intronic
965647879 3:170902899-170902921 CTACAAAAAGAAGCTGAGGCCGG - Intronic
965720530 3:171656465-171656487 CTAAAATAATAAAATTAGGCTGG - Intronic
965752354 3:171989406-171989428 CTCTAAAGATGAATTGTGGCTGG - Intergenic
966004240 3:174988870-174988892 CTATAAAAACTACCTGAGGCTGG + Intronic
966209003 3:177433558-177433580 CTAGAGAAATAATTTGAGGTTGG - Intergenic
966247899 3:177829376-177829398 TTAAAAAAATTAATAGAGGCTGG + Intergenic
966518871 3:180850847-180850869 CTATCTAAAGGAATTGAGGCTGG - Intronic
966736529 3:183191169-183191191 CTAAAAAAATAAAGTCAGCCGGG - Intronic
966858826 3:184216820-184216842 CTAAAAAAATAAAAACAGGCTGG - Intronic
966900468 3:184480464-184480486 CTTAAAGAATAAATTGAGGTAGG - Intronic
966991731 3:185238941-185238963 ATACAAAAATTAATTGAGGATGG - Intronic
967324551 3:188226303-188226325 TTATAGAAATAAAATGAGGCTGG - Intronic
967491803 3:190100492-190100514 ATATTAAAATATATTGAAGCTGG + Intronic
967675737 3:192296518-192296540 GTTTAAAAATAAAATGAGGCTGG - Intronic
968178460 3:196571004-196571026 ATAGAAAAACAACTTGAGGCCGG - Intronic
968283974 3:197497427-197497449 CCATAAAAAAAAAGTGGGGCGGG + Intergenic
968712897 4:2133007-2133029 ATATAAAAATAGCTTGTGGCTGG + Intronic
968991491 4:3916268-3916290 TTAGAAAAATAAGTGGAGGCTGG + Intergenic
968994051 4:3934327-3934349 AAATAAAAATAAATTGAGGAAGG + Intergenic
969226844 4:5804232-5804254 CTTTAAAAGTAAAGTGAGGCCGG - Intronic
969819882 4:9711916-9711938 AAATAAAAATAAATTGAGGAAGG - Intergenic
969848334 4:9937157-9937179 CTCTAAATCTAAAGTGAGGCTGG + Intronic
969909442 4:10429876-10429898 CTATCAAAATAAATATAGACTGG + Intergenic
970796761 4:19921883-19921905 ATAAAAATATAAATAGAGGCTGG + Intergenic
970981101 4:22098370-22098392 ATATAAAGAAAAATTAAGGCTGG + Intergenic
971415849 4:26428466-26428488 CTAAAAAAAAAAAATCAGGCAGG - Intronic
971799154 4:31266243-31266265 ATATGAAAATAAATTTAGGCCGG + Intergenic
971807848 4:31383733-31383755 ATATGAAAATAATTTGAGGGAGG + Intergenic
971822399 4:31575131-31575153 GTTTAATAATAAAGTGAGGCAGG + Intergenic
971934566 4:33131469-33131491 CTACAAAAACAAAATGAGCCGGG + Intergenic
972307747 4:37848771-37848793 TTATAAAAATTAAATAAGGCTGG + Intronic
972462504 4:39317858-39317880 CTATACAAAGAAATGGCGGCCGG + Intronic
972511597 4:39772131-39772153 CGATAAAAGTTAATTTAGGCTGG - Intronic
972577335 4:40364094-40364116 ATATAAAGATAATTTGAGGAAGG + Intergenic
972645077 4:40960279-40960301 TTAAAAAAAGAATTTGAGGCAGG + Intronic
973036983 4:45419376-45419398 CTTTAAACATAAATTGATGCTGG + Intergenic
973146153 4:46830027-46830049 CTATAAAAATGGATAGAGGCCGG + Intronic
973154594 4:46935064-46935086 TTATAAAAATAATCTGAGACTGG + Intronic
973169751 4:47125948-47125970 ATATAAATATATATTAAGGCTGG + Intronic
973549114 4:52013955-52013977 TTTAAAAAATAACTTGAGGCCGG + Intronic
974204371 4:58681659-58681681 CTAACAAAATCAGTTGAGGCAGG - Intergenic
974372848 4:61040405-61040427 CTATAAGAAAAAAGAGAGGCCGG + Intergenic
974822868 4:67090112-67090134 ATTTAAAAGTAATTTGAGGCAGG - Intergenic
974960626 4:68695073-68695095 CTATAATAATCAAATGAGCCTGG - Intergenic
975176283 4:71293135-71293157 CTTAAAAACAAAATTGAGGCCGG - Intronic
975317215 4:72968494-72968516 CTCAAAAAATGAATTGTGGCTGG + Intergenic
975338365 4:73207890-73207912 GTATTAAAAAAACTTGAGGCCGG + Intronic
975339927 4:73227447-73227469 CTATAAAATTAGGTTGAGGCTGG - Intronic
975598130 4:76069684-76069706 CAATAAAAAGGAATTAAGGCCGG - Intronic
975658052 4:76661090-76661112 CTTTAAAAACAAATTAAGCCAGG - Intronic
976260596 4:83141337-83141359 CTCAAAAAATAAAATAAGGCCGG + Intergenic
976930555 4:90561889-90561911 CTGTAAAGATAAATTTAGGCCGG + Intronic
977375026 4:96191442-96191464 CTATTCCAAAAAATTGAGGCGGG + Intergenic
978025169 4:103864618-103864640 CCATAAAAATTAATTCAGGATGG - Intergenic
978344114 4:107748433-107748455 CCATAATAAGAAATTGAGACAGG + Intergenic
978502828 4:109427346-109427368 ACATAAAAATAAATCTAGGCTGG + Intergenic
978583336 4:110253779-110253801 TTTTAAAAATAAATTCTGGCTGG + Intergenic
978746509 4:112201043-112201065 TTTTAAAAATAATTTTAGGCCGG + Intergenic
979193009 4:117886308-117886330 CTATAAAAATTATTTCTGGCTGG + Intergenic
979231075 4:118349704-118349726 CTACAAGAATGAAATGAGGCCGG + Intronic
979406903 4:120323995-120324017 ATAGAAAAATAAAATGATGCTGG - Intergenic
979536796 4:121830909-121830931 GTATAAAAATTATTAGAGGCCGG + Intronic
980047378 4:128004133-128004155 CTAAAAAAACAAAAAGAGGCAGG - Intronic
980300649 4:130987036-130987058 CTATAAAGAAATACTGAGGCTGG - Intergenic
981526722 4:145714076-145714098 GTCTAAAAATAAAATGAGCCAGG - Intronic
981573996 4:146184493-146184515 CTATAAAAATAAAATTAAACTGG - Intronic
981951775 4:150418281-150418303 ATTTAAAAATAAATTGGGCCAGG - Intronic
981968903 4:150640151-150640173 AATTAAAAATAAATTGGGGCCGG - Intronic
982744727 4:159094763-159094785 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
982744750 4:159094895-159094917 CTAGAAAAAAAAATGCAGGCCGG - Intergenic
983141985 4:164161423-164161445 CTATTAAAAATACTTGAGGCTGG - Intronic
983693798 4:170504105-170504127 CTCTAAAAATAAATTATGTCAGG + Intergenic
983770977 4:171548478-171548500 CTTTAAAAATAACTTTTGGCCGG - Intergenic
984263371 4:177468218-177468240 CTATAAAAATAAATTTTTGTTGG + Intergenic
984449698 4:179883555-179883577 AAAGAACAATAAATTGAGGCCGG - Intergenic
984671688 4:182496765-182496787 CTGTAAGGACAAATTGAGGCTGG + Intronic
984768042 4:183414439-183414461 AAATATATATAAATTGAGGCTGG + Intergenic
984897312 4:184553146-184553168 CTTTAAAAAAAAATTGAGATGGG + Intergenic
985209170 4:187573351-187573373 CTATAAAAATAAAATCAGTAAGG - Intergenic
985263378 4:188135893-188135915 CTTTAAAAATAAAGTTAGCCAGG - Intergenic
985328863 4:188804146-188804168 CTATTAAAATAAGTATAGGCTGG - Intergenic
985510017 5:308152-308174 ATCTAAAAATAACTTCAGGCCGG - Intronic
986158083 5:5196824-5196846 ATATATAAAGAAACTGAGGCTGG + Intronic
986295742 5:6436686-6436708 CTAGAAAAATATAATTAGGCTGG - Intergenic
987348205 5:16997547-16997569 CTTTTAAAAGAACTTGAGGCCGG + Intergenic
987966924 5:24889435-24889457 CTATAAAAATACTGTGAGACTGG - Intergenic
988428917 5:31096149-31096171 CTAATAAAATAAAATGATGCAGG + Intergenic
988501220 5:31785442-31785464 ATATATAAATATATTGAGACAGG + Intronic
988838670 5:35061195-35061217 CTTTAAAAAAAAATAGAGGAAGG + Exonic
989119536 5:37990475-37990497 CCATAAAAGTAAAGTGAGACTGG - Intergenic
989163726 5:38415064-38415086 ATATAAGAATTAATTGAGCCAGG + Intronic
989525487 5:42448789-42448811 ATATAAAAATCAATTCAGGATGG - Intronic
989620079 5:43375693-43375715 CTATATAAAGAACTTGGGGCCGG + Intergenic
990313381 5:54561335-54561357 TTAAAAAAATAAAAGGAGGCCGG - Intergenic
990734808 5:58848150-58848172 ATATAAAAATTTATGGAGGCTGG - Intronic
990751700 5:59023345-59023367 CTTTAAAAATATTCTGAGGCTGG + Intronic
991183095 5:63777374-63777396 TTATAATAAGAAATTAAGGCCGG - Intergenic
991279020 5:64889627-64889649 TCATAAAAGCAAATTGAGGCCGG + Intronic
991417346 5:66406115-66406137 CTATAAAGATAAATTTTGGCTGG - Intergenic
991465853 5:66911403-66911425 CTCTAATAATAAGTTCAGGCTGG + Intronic
991679269 5:69122355-69122377 TTTTAAAAAGAAAATGAGGCTGG + Intronic
991713183 5:69428203-69428225 AAATAAAAAAAAATTTAGGCCGG + Intronic
991774520 5:70071798-70071820 TTTTAAAAATAATTTTAGGCCGG - Intronic
991853814 5:70947223-70947245 TTTTAAAAATAATTTTAGGCCGG - Intronic
992118993 5:73571637-73571659 ATTTAAAAATAAGTTGAGGCGGG + Intronic
992371688 5:76150470-76150492 TTAGAAAAATAAACAGAGGCTGG - Intronic
992476575 5:77108382-77108404 CTTTAAAAATATATTAATGCAGG + Intergenic
992588645 5:78270205-78270227 CTAGAAAAATAAAATGGGCCAGG - Intronic
992758066 5:79927562-79927584 CTATAAAAATAAATTCATGGAGG + Intergenic
992768239 5:80023030-80023052 CTTTAATAAATAATTGAGGCTGG - Intronic
992956717 5:81917516-81917538 ATATTAAAAAAAATTGGGGCCGG + Intergenic
993205127 5:84868996-84869018 CTCTAAAAGTAAAATGTGGCTGG + Intergenic
993363533 5:87006623-87006645 TTATTAAAATAATTTGAGGCCGG - Intergenic
993477153 5:88379956-88379978 CTTTAAAAATAAAAGTAGGCTGG - Intergenic
993562638 5:89429822-89429844 GTATAGAATTACATTGAGGCTGG - Intergenic
993667657 5:90721198-90721220 CTATAAATATGTGTTGAGGCTGG + Intronic
993755793 5:91728109-91728131 CTATAAAAAATACTTGAGACTGG + Intergenic
993831058 5:92758349-92758371 ATATAAAAACATAATGAGGCCGG - Intergenic
993874398 5:93289493-93289515 TTGTGAAAATAATTTGAGGCTGG - Intergenic
994009866 5:94889290-94889312 GACTAAAAATAAATTCAGGCCGG + Intronic
994036663 5:95209554-95209576 CTAAAAGAGTAAATTGAGACTGG - Intronic
994089762 5:95799822-95799844 CTAAAAAATAAAATTAAGGCCGG + Intronic
994126602 5:96174036-96174058 CTTAAAAAATAAGTTCAGGCCGG - Intergenic
994245887 5:97475840-97475862 TTTTTTAAATAAATTGAGGCCGG - Intergenic
995041351 5:107591524-107591546 TAATAAAAATGTATTGAGGCCGG + Intronic
996049526 5:118916367-118916389 CTATTAAAAGACATTAAGGCCGG + Intronic
996066198 5:119082270-119082292 CTAAAAAAATAAAATAAGCCAGG - Intronic
996149809 5:120021734-120021756 ATATAAAAAGATGTTGAGGCCGG - Intergenic
996310444 5:122098339-122098361 CTTTAAAAATAAAAATAGGCCGG - Intergenic
996363251 5:122673832-122673854 CAATGCAAATAAACTGAGGCAGG - Intergenic
996646006 5:125817664-125817686 ATAACAAAATAATTTGAGGCTGG - Intergenic
996843013 5:127869024-127869046 CTACAAAAATGAAATGAGGCCGG + Intergenic
996877531 5:128255730-128255752 TTTTAAAAAAAAATGGAGGCTGG + Intergenic
997572996 5:134947380-134947402 AAAAAAAAAAAAATTGAGGCCGG - Intronic
997812118 5:136980867-136980889 CCATAAAAATATCTTGAGCCTGG + Intronic
998063787 5:139139972-139139994 ATACAAAAATTAGTTGAGGCTGG + Intronic
998233239 5:140375155-140375177 ATATAAAAATAATTTTTGGCTGG + Intergenic
998455609 5:142270369-142270391 AAAAAAAAATAAATTTAGGCTGG + Intergenic
998572104 5:143270431-143270453 ATTTAAAAATAGTTTGAGGCTGG - Intergenic
998651182 5:144123448-144123470 TTTTAAAAATATTTTGAGGCTGG + Intergenic
998867375 5:146518913-146518935 ATATAAAAAAAAATTTAGCCAGG - Intergenic
998918370 5:147040865-147040887 ATTTAAAAATACCTTGAGGCTGG + Intronic
998989198 5:147796403-147796425 CAATAAAGATAAAATGAGCCTGG + Intergenic
999137362 5:149331322-149331344 AAATAAAAATAAATTGAGGCTGG + Intronic
999589000 5:153123486-153123508 ATAAAAAAAAAAATTGAGCCTGG + Intergenic
999611338 5:153373123-153373145 TTTTAAAAATTAATTGAGGTCGG + Intergenic
1000030246 5:157395268-157395290 CAAAAAAAATAAAAAGAGGCTGG - Intronic
1000240040 5:159400817-159400839 CTATTAAAGGGAATTGAGGCTGG - Intergenic
1000414751 5:160972118-160972140 CTTTAAAAAAAAATGGAGCCAGG - Intergenic
1000466936 5:161590926-161590948 CTATTCAAAAAAATTGAGGAGGG - Intronic
1000570600 5:162908797-162908819 CTATAAAAATATATAGATGGGGG + Intergenic
1000781821 5:165491700-165491722 CTTTAAAAAAATATTGAGACAGG - Intergenic
1000888724 5:166778645-166778667 CATTAAAAAAAAATTTAGGCTGG - Intergenic
1001098329 5:168793786-168793808 CTTTAAAAATGAATTGGGGGGGG + Intronic
1001409690 5:171502034-171502056 TTATATAATTAAATTGAGACAGG + Intergenic
1001458079 5:171882599-171882621 TTTTAAAAATATTTTGAGGCTGG - Intronic
1001658753 5:173374646-173374668 CTCAATAAATAAATTGGGGCTGG + Intergenic
1002035751 5:176468286-176468308 GTATAGAAGTAAATAGAGGCTGG + Intronic
1002118355 5:176983128-176983150 TTACAAGATTAAATTGAGGCTGG - Intronic
1002284033 5:178150375-178150397 CAAAAAAAAAAAATAGAGGCTGG - Exonic
1002444799 5:179283619-179283641 ATATAACAATAAATGTAGGCTGG + Intronic
1002886014 6:1295070-1295092 CTATCAATATAAATTGAAGTCGG + Intergenic
1002967493 6:1981231-1981253 CAAAAAAAAAAAATTCAGGCTGG + Intronic
1003316500 6:5017189-5017211 CTATAAATGAAAACTGAGGCTGG - Intergenic
1003480868 6:6531827-6531849 GTATAAAAATAAACTGATGCAGG - Intergenic
1003653269 6:7982300-7982322 TTTTAAAAATAAATTCAGGCTGG + Intronic
1004173132 6:13314577-13314599 CAATAAAAATAATTTCAGCCTGG - Intronic
1004225510 6:13780996-13781018 CATTTAAAATAAATTGAGACAGG - Intergenic
1004247882 6:13997516-13997538 TTACAAAAATAATTTTAGGCTGG - Intergenic
1004263757 6:14131412-14131434 TTACAAACATAAGTTGAGGCTGG + Intronic
1004391728 6:15215673-15215695 CTATAAAGAAAAATACAGGCTGG + Intergenic
1004488896 6:16094935-16094957 CCATCAAAATATAATGAGGCTGG + Intergenic
1004551071 6:16647777-16647799 CTGGAAAAATAAAATAAGGCCGG + Intronic
1004573220 6:16868089-16868111 CCATAAAAATAATTTGAGGTAGG - Intergenic
1004597367 6:17113055-17113077 CTTTAAAAATAAATTGGAACTGG - Intronic
1004682318 6:17908301-17908323 ATTTAAAAATTAATTGAGGCTGG + Intronic
1004782991 6:18933002-18933024 CTTTAAACATAAATTCAGGAGGG + Intergenic
1004884620 6:20039652-20039674 CTATAAAAACAGAATGAGGCCGG + Intergenic
1005428004 6:25724125-25724147 CTATAAGAAGAAATCAAGGCTGG + Intergenic
1005444375 6:25906170-25906192 GTATTCAAATAAATTGAGGTGGG - Intergenic
1005721339 6:28605535-28605557 TTTTAAAAATGAAATGAGGCCGG + Intronic
1006018182 6:31099624-31099646 ATAAAATAATAAAATGAGGCCGG - Intergenic
1006095517 6:31653837-31653859 CTATAAAAATAAAATTAGCCAGG - Intronic
1006168098 6:32077322-32077344 CAAAGAAAATAAATTGAGGGTGG + Intronic
1006226413 6:32540429-32540451 CTATAAAATTTAATTGTGGCCGG - Intergenic
1006461965 6:34164716-34164738 CTAAAAATACAAAATGAGGCAGG + Intergenic
1006488533 6:34365744-34365766 CTCTGAAAATAAATACAGGCCGG + Intronic
1006585134 6:35105225-35105247 CAATTAAAAGAGATTGAGGCCGG + Intergenic
1006620514 6:35360777-35360799 CTCTAAAAATAAATCGGGGATGG - Intronic
1007638780 6:43319179-43319201 ACATAAGAATATATTGAGGCTGG + Intronic
1007671329 6:43556830-43556852 CAATAAAAAGAAATGAAGGCCGG + Intronic
1007834580 6:44664799-44664821 GTAGAAACATAAATTAAGGCAGG - Intergenic
1007852320 6:44814971-44814993 TTATGAAAAAAATTTGAGGCCGG - Intronic
1008616721 6:53233399-53233421 CTTTAATAATAACTTCAGGCTGG - Intergenic
1008772860 6:55000697-55000719 CTCTAAAAATAAATTGCGATGGG - Intergenic
1009433532 6:63592472-63592494 GTATAAAAATAAATACAGCCAGG + Intergenic
1009445649 6:63739209-63739231 CTAGAAAAATAACCTGAGACAGG - Intronic
1009785817 6:68337712-68337734 ATATAAAAGCAAATTTAGGCCGG - Intergenic
1009808217 6:68629557-68629579 TTAAAAAAATAAAAGGAGGCCGG + Intergenic
1010032310 6:71284115-71284137 CTATAATAAAAAATGCAGGCTGG + Intergenic
1010197875 6:73257957-73257979 AAATAAAAATAAATTGTGCCAGG + Intronic
1010426683 6:75735378-75735400 CTATTAAAAAGGATTGAGGCTGG - Intergenic
1010525556 6:76895961-76895983 CTATAAAAAATACCTGAGGCTGG - Intergenic
1010891888 6:81323354-81323376 TCATAAAAATTAAATGAGGCCGG + Intergenic
1011005233 6:82637030-82637052 CTACAAAAATTAATTCAGGATGG + Intergenic
1011045369 6:83076225-83076247 ATATGAAAAGATATTGAGGCCGG + Intronic
1011452042 6:87503461-87503483 CTATAAAAATATTATGTGGCTGG + Intronic
1011891836 6:92173445-92173467 CTATATAAATAAATTCAGAGTGG - Intergenic
1012400473 6:98838548-98838570 AAATAAATATACATTGAGGCAGG - Exonic
1012471951 6:99582236-99582258 CTCTAGAAAAAAATTAAGGCTGG + Intergenic
1012696762 6:102393750-102393772 GTAAAAAAATAAATTGAGAAAGG + Intergenic
1012958551 6:105597262-105597284 ATATCAAAATATATAGAGGCCGG - Intergenic
1012995739 6:105971484-105971506 GTACAAAAATAAACTCAGGCTGG - Intergenic
1013556860 6:111264930-111264952 CTAAAAATATAAAATGAGCCAGG + Intronic
1013769523 6:113612275-113612297 CTTTTTAAATAAATAGAGGCAGG + Intergenic
1013988713 6:116228345-116228367 CTAAAAATATAAAATCAGGCGGG + Intronic
1014031131 6:116706391-116706413 TTATAAAAACAATTTCAGGCTGG + Intronic
1014228357 6:118873956-118873978 TTAAAAAAATCAATTAAGGCTGG + Intronic
1014266056 6:119278987-119279009 CTATAAAAGAATACTGAGGCTGG - Intronic
1014523678 6:122475487-122475509 CTATAAAAGTAAAAATAGGCCGG + Intronic
1015125940 6:129754680-129754702 TTACTAAAATAAATTGAGACTGG - Intergenic
1015274115 6:131366943-131366965 CCTTAAAAAAAAGTTGAGGCCGG + Intergenic
1015464061 6:133528237-133528259 GTATAAAAATAATTTGAAGCAGG - Intronic
1015652979 6:135483463-135483485 TTATAAAAATAAAGTGAGAGAGG + Intronic
1015844983 6:137510937-137510959 CAATAAAACAAAAATGAGGCTGG - Intergenic
1015950742 6:138550076-138550098 CTAAAAATATAAAATGAGCCAGG + Intronic
1016022959 6:139255116-139255138 TCATAAAAAGAAAATGAGGCCGG - Intronic
1016315948 6:142787093-142787115 CTATAAAAAAAAATTTAAGCAGG + Intronic
1016552215 6:145294555-145294577 CAAAAAAAATAAAATAAGGCCGG + Intergenic
1016716785 6:147242388-147242410 TTTTAAAAATAAATTTAGCCTGG + Intronic
1016962902 6:149690507-149690529 ATAAAAATATAAGTTGAGGCTGG - Intronic
1017076323 6:150622327-150622349 ATTTAAAAAAAAATTAAGGCTGG - Intronic
1018022448 6:159774605-159774627 CATTAAAAATAAATTTAGCCGGG - Intronic
1018218804 6:161558264-161558286 CTATTAAAAAAAATTCAGTCAGG + Intronic
1018780012 6:167054773-167054795 GTAGAAAAATAAATGTAGGCCGG - Intergenic
1018955379 6:168406563-168406585 CCATATCAATAAATTGTGGCGGG + Intergenic
1020318281 7:6922387-6922409 AAATAAAAATAAATTGAGGAAGG + Intergenic
1020492253 7:8801982-8802004 CAATGAAAATGACTTGAGGCTGG + Intergenic
1021170381 7:17392135-17392157 CTATAAAAGAACATTGAGACTGG + Intergenic
1021397927 7:20173134-20173156 TTATAAAAATAAATGAAGCCTGG - Intronic
1021721474 7:23508792-23508814 CTACAAAAATAAATGCATGCAGG - Intronic
1021722375 7:23516811-23516833 CTATAAAATAAAATCGTGGCCGG + Intronic
1021797383 7:24270266-24270288 CTTTAAAAAAAAATTACGGCCGG + Intergenic
1022126280 7:27360770-27360792 ATATAAAAATGAATGGTGGCTGG + Intergenic
1022332654 7:29395224-29395246 TTCTAAAAATAAATTATGGCTGG + Intronic
1022730998 7:33025886-33025908 CATTAAAAATAAAATAAGGCTGG + Intronic
1022733407 7:33053498-33053520 CTCTAAAAATAAAATTAGTCAGG + Intronic
1022937861 7:35199197-35199219 AAAAAAAAAAAAATTGAGGCCGG + Intergenic
1024092834 7:45960850-45960872 TTATGAAAAGAAATTGAGCCAGG + Intergenic
1024162548 7:46692098-46692120 ATATAAAAAAAATTGGAGGCTGG + Intronic
1024201323 7:47109590-47109612 CTTTAAAAATAATTTCAGGCCGG + Intergenic
1024440072 7:49406708-49406730 CTATAAAAACTAAGTGAGGCTGG - Intergenic
1024586655 7:50848133-50848155 CTATAAAAGTCATTTGAGGAAGG - Intergenic
1025619807 7:63158417-63158439 CAATAAAAATAAATAGGGCCAGG + Intergenic
1025720243 7:64004102-64004124 CTTTATAATTAAATTTAGGCCGG + Intergenic
1026082244 7:67232239-67232261 GGATAAAAATAAAAAGAGGCTGG - Intronic
1026145856 7:67745898-67745920 TTATAAAAATAAAGAGGGGCTGG - Intergenic
1026694826 7:72581755-72581777 GGATAAAAATAAAAAGAGGCTGG + Intronic
1026855863 7:73754330-73754352 TTAAAAAAAGAAATTTAGGCCGG + Intergenic
1026883939 7:73925721-73925743 CTATAATTAAAAAATGAGGCTGG - Intergenic
1026936259 7:74257814-74257836 CTCAAAAAATAAATAAAGGCTGG - Intergenic
1026965778 7:74439026-74439048 CAATAAAAATCTATTGAGCCGGG + Intergenic
1027441956 7:78229014-78229036 CAATGCAAATCAATTGAGGCTGG + Intronic
1027485699 7:78759276-78759298 CTATACAAATAATTTTAGGTAGG - Intronic
1027558766 7:79700115-79700137 AAAAAAAAAAAAATTGAGGCTGG + Intergenic
1027792282 7:82649834-82649856 CTATAAAAATATATTTGGGTGGG + Intergenic
1027857093 7:83525975-83525997 CTAAAGAAATATATTGATGCTGG - Intronic
1028320333 7:89451423-89451445 CTGTAAGAATAAATTAAAGCAGG + Intergenic
1028398010 7:90393294-90393316 CTATTAAAAAAATCTGAGGCTGG - Intronic
1028440069 7:90849398-90849420 CTATAAAGAAATACTGAGGCTGG - Intronic
1028593272 7:92521260-92521282 CTGTAAGAATAATGTGAGGCTGG - Intronic
1028607845 7:92674371-92674393 ATATAAACATAGATTAAGGCAGG - Intronic
1028768411 7:94586796-94586818 ATTTAAAACTAAATGGAGGCTGG - Intronic
1028947484 7:96596985-96597007 CTATAAAATTACACTGAAGCTGG + Intronic
1029183583 7:98722088-98722110 CTAAAAAAAAAAATTGGAGCGGG - Intergenic
1029193309 7:98786936-98786958 GTATAAAATCAACTTGAGGCTGG - Intergenic
1029332625 7:99872112-99872134 ATAAAAAAATGAATTCAGGCCGG - Intergenic
1029397335 7:100317307-100317329 CTCTAAAAAGAAACTCAGGCTGG + Intronic
1029442958 7:100597688-100597710 TAATAAAAATAAAAAGAGGCTGG - Intronic
1030064569 7:105649461-105649483 CTAGAAAGATAAATTCAGACAGG - Intronic
1030090760 7:105856287-105856309 CTACAAAAAAGAATTTAGGCTGG + Intronic
1030129301 7:106183661-106183683 CTTTAAAAATAGTATGAGGCTGG - Intergenic
1030305467 7:108014008-108014030 CTATAAAAATAATTTCTGGGTGG - Intergenic
1030665604 7:112274451-112274473 CTATAAAAGTTAATAAAGGCAGG - Intronic
1030775301 7:113527596-113527618 CTAGAAAATTAAGTAGAGGCAGG - Intergenic
1030885673 7:114933551-114933573 TTATAAAAAGGAATGGAGGCTGG - Intronic
1031319102 7:120299158-120299180 CTAAAAAAAAAAATTGAGAATGG + Intronic
1031787117 7:126046630-126046652 AAATAAAAATAAAATCAGGCCGG - Intergenic
1031866755 7:127045573-127045595 TTAAAAAAATAAATTGAAGATGG - Intronic
1032029921 7:128474591-128474613 GTATAAAATTAAGTTTAGGCCGG + Intergenic
1032381617 7:131489680-131489702 CTGTAAAAATAAATGGTGGAGGG - Exonic
1032578973 7:133086178-133086200 ATATAAAAATCAATTGTAGCCGG + Intergenic
1032974633 7:137208521-137208543 CTGTCAAAATAAAGAGAGGCAGG + Intergenic
1032978279 7:137251059-137251081 CTTTAAAAATACTTTGAAGCAGG - Intronic
1033012177 7:137634559-137634581 CTATAACAATGGATTAAGGCTGG - Intronic
1033040935 7:137917774-137917796 CTTGGGAAATAAATTGAGGCTGG - Intronic
1033639710 7:143249993-143250015 CTACAAAAATAAAATTAGCCAGG + Intronic
1034006290 7:147476071-147476093 AAATAAAAATAAACAGAGGCGGG - Intronic
1034082772 7:148295785-148295807 CTTTAAAAATTAATTGAGGCCGG - Intronic
1034202092 7:149289144-149289166 CTAAAAATATAAAATGAGCCGGG - Intronic
1034444567 7:151107011-151107033 TTATAAAAATATTTTGCGGCCGG + Intronic
1034643589 7:152624740-152624762 ATACAAATATAAAATGAGGCTGG + Intergenic
1035158097 7:156930396-156930418 CTTTAAAAATGCATTTAGGCTGG - Intergenic
1035190385 7:157162487-157162509 ACAAAAAAATAAATTTAGGCTGG - Intronic
1035886351 8:3295420-3295442 GTACAAAAGCAAATTGAGGCTGG - Intronic
1036382047 8:8242271-8242293 AAATAAAAATAAATTGACGAAGG - Intergenic
1036412776 8:8518222-8518244 AAAAAAAAATAAAATGAGGCTGG + Intergenic
1036428290 8:8666581-8666603 CTATAAAAATTATTTGAGGGTGG - Intergenic
1036468356 8:9024719-9024741 CTATAAAAACATAAAGAGGCTGG - Intronic
1036850582 8:12198099-12198121 CTCAAAAAAAAAATTGAGTCAGG + Intergenic
1036871947 8:12440364-12440386 CTCAAAAAAAAAATTGAGTCAGG + Intergenic
1037399162 8:18476300-18476322 CTTTTAAAAGAAATTGGGGCAGG + Intergenic
1037445467 8:18961386-18961408 CCATAAAAATAAATATATGCAGG + Intronic
1037534171 8:19809475-19809497 CTATAAAAAATAATATAGGCCGG - Intergenic
1037744743 8:21633844-21633866 TTATAAAAATGAGTTCAGGCTGG + Intergenic
1037844080 8:22267173-22267195 CTTAAAAAAAAAATTGAGACAGG + Intergenic
1038132585 8:24749726-24749748 CTACAAAAAAAATCTGAGGCTGG + Intergenic
1038380463 8:27088398-27088420 TAATAAAAATAAAATGTGGCTGG + Intergenic
1038472212 8:27834595-27834617 CTATGAAAATAAAATGAGGCCGG + Intronic
1038654642 8:29438154-29438176 CTATAAAAATAAATAAGGCCGGG - Intergenic
1038849498 8:31261812-31261834 TTATAATAAAAAGTTGAGGCTGG + Intergenic
1039052147 8:33504924-33504946 CTGTAAAAAGAAAAAGAGGCTGG + Intronic
1039203245 8:35120116-35120138 CATTAAAAATAAATTTCGGCTGG - Intergenic
1039318938 8:36406817-36406839 CCATAAAAATAAATAGAGATAGG - Intergenic
1039414278 8:37380079-37380101 CTACAAAAATAAAATTAGCCAGG + Intergenic
1039460591 8:37740621-37740643 ATATATATATAAAATGAGGCTGG + Intronic
1040450160 8:47538246-47538268 CTATGAAAATAAATTAAGGCTGG + Intronic
1040465102 8:47687764-47687786 CTTTAGAAATATATTTAGGCTGG + Intronic
1040764528 8:50891375-50891397 CTATAAAAATATATTCAGCTGGG + Intergenic
1040778970 8:51083367-51083389 CTTGAAAAATAAATAGAGGCCGG - Intergenic
1040826756 8:51630270-51630292 ATATAAAAATAAATTCAAGATGG + Intronic
1041468122 8:58178389-58178411 ATATAACAATAAACAGAGGCTGG + Intronic
1041866244 8:62577201-62577223 TTAAAAAAATGAATTGAGGTGGG - Intronic
1042164050 8:65928095-65928117 TTTTAAAAATAAATTTAGGGTGG - Intergenic
1042240324 8:66657199-66657221 CTTTAAAAATACATTTTGGCTGG - Intronic
1042276112 8:67007037-67007059 CTAAAAAAAAAAAAAGAGGCCGG - Intronic
1042276261 8:67008153-67008175 CAATAATAATAAATGGAGGCTGG - Intronic
1042552124 8:70003426-70003448 AAAAAAAAAAAAATTGAGGCTGG - Intergenic
1042621333 8:70708903-70708925 CTATTCCAAAAAATTGAGGCAGG + Intronic
1042814168 8:72860013-72860035 CAATAAAAAGAAATGAAGGCCGG - Intronic
1043481754 8:80660174-80660196 TTATAAAAAACAATTGGGGCTGG + Intronic
1043603005 8:81963369-81963391 ATTTAAATAAAAATTGAGGCTGG - Intergenic
1043934491 8:86128072-86128094 CTAAAAAAATAAAATAAAGCTGG + Intronic
1043938981 8:86175000-86175022 TTATAAGACTGAATTGAGGCAGG - Intergenic
1044297623 8:90546651-90546673 CTATAAAGAAAAAGAGAGGCTGG - Intergenic
1044778669 8:95721116-95721138 CAATAAAGATTAATTTAGGCCGG - Intergenic
1045473179 8:102531165-102531187 TTTTAAAAATAAAATTAGGCTGG + Intronic
1045514234 8:102842918-102842940 CAAAAAAAAAGAATTGAGGCTGG + Intronic
1045669387 8:104530909-104530931 CTATGAAAAAAAATTGATGCAGG + Intronic
1045714983 8:105032507-105032529 GTTTAAAAATAAATTTTGGCTGG + Intronic
1046126312 8:109913200-109913222 CCTTAAAAATAAATTAAGGCTGG - Intergenic
1046196939 8:110877711-110877733 AAAGAAAAACAAATTGAGGCAGG + Intergenic
1046588839 8:116181135-116181157 TTTTAAATACAAATTGAGGCCGG - Intergenic
1046944016 8:119957885-119957907 CTAGAAAAGAAAATAGAGGCCGG - Intronic
1047139820 8:122125419-122125441 CTATAAAAAAAATCTGAGACTGG + Intergenic
1047253043 8:123194876-123194898 GTCTAAACACAAATTGAGGCTGG - Intronic
1047316325 8:123737155-123737177 CTTTTAAAATGCATTGAGGCCGG - Intronic
1047482947 8:125301956-125301978 CAAAAAAAAAAAATTGGGGCAGG - Intronic
1047636006 8:126763257-126763279 TTTTAAAAATATACTGAGGCTGG - Intergenic
1047649185 8:126901205-126901227 CTTTAAAAAAAGATGGAGGCTGG + Intergenic
1048669792 8:136705067-136705089 AAATAAAAATAAATTGTGACAGG - Intergenic
1048860027 8:138717441-138717463 ATAAAAAAATAAATTCTGGCCGG - Intronic
1048941059 8:139401272-139401294 ATATGAAAATAACTTAAGGCTGG + Intergenic
1049101917 8:140586194-140586216 CTACAAAAATAAAGTCAGGCTGG + Intronic
1049105899 8:140612597-140612619 CTATAAATATAAAATTAGCCGGG + Intronic
1049898313 9:132225-132247 ATGTAAAAATACATTGAGGCCGG + Intronic
1050352175 9:4750737-4750759 CTATAACAAAATATTGAGACTGG + Intergenic
1050400910 9:5253618-5253640 ATATAAAAATAAATTCAAGATGG - Intergenic
1050510111 9:6385248-6385270 CAATAAAAAGACATAGAGGCTGG + Intergenic
1050530694 9:6586469-6586491 CTTTACAAAGAAATTGAGGCTGG + Intronic
1050823983 9:9920481-9920503 TTATAAAAATAAAATGATGGAGG + Intronic
1050996398 9:12224324-12224346 CTATAAAAAATACCTGAGGCTGG + Intergenic
1051112654 9:13657021-13657043 TTTTAAAAATACACTGAGGCTGG + Intergenic
1051228849 9:14932236-14932258 CTAAAAACATACATTGAGGCTGG - Intergenic
1051256049 9:15215245-15215267 TCAAAAAAATAAAATGAGGCTGG + Intronic
1051518009 9:17952248-17952270 CTAAAGAAAAAAAATGAGGCTGG - Intergenic
1051661378 9:19430266-19430288 CTATAAAAATATTTTGATGATGG + Intronic
1051754832 9:20387912-20387934 CTATAAACAGAAATACAGGCAGG + Intronic
1051952737 9:22656582-22656604 CTATGAAAATCAATGGAGTCTGG - Intergenic
1052551308 9:29952733-29952755 ATATAAAAATAATTATAGGCTGG - Intergenic
1052556356 9:30023213-30023235 CTATAAAAAAAACCTGAGACTGG + Intergenic
1052625546 9:30972316-30972338 AAATAAAAATAAAATGTGGCTGG + Intergenic
1052749726 9:32477626-32477648 CTTTAAAAATATAGTCAGGCCGG + Intronic
1052789118 9:32858028-32858050 ATTTAAAAATAAATTTAGCCAGG + Intergenic
1053194578 9:36106532-36106554 CTTTAAAAATATTTTAAGGCCGG - Intronic
1053252943 9:36590214-36590236 ATATAAAACTAGAATGAGGCTGG - Intronic
1053408600 9:37900132-37900154 CTTTAAAAATAAAAATAGGCTGG - Intronic
1053741376 9:41142505-41142527 ATGTAAAAATACATTGAGGCCGG + Intronic
1053841933 9:42194681-42194703 CTAATAAAATATATTGAGGAAGG + Intergenic
1054346588 9:63972008-63972030 ATGTAAAAATACATTGAGGCCGG + Intergenic
1054444365 9:65298657-65298679 ATGTAAAAATACATTGAGGCCGG + Intergenic
1054485907 9:65722848-65722870 ATGTAAAAATACATTGAGGCCGG - Intronic
1054587350 9:66981488-66981510 CTAATAAAATATATTGAGGAAGG - Intergenic
1054686973 9:68288789-68288811 ATGTAAAAATACATTGAGGCCGG - Intronic
1054773135 9:69101540-69101562 CTTTTAAAACAAATTTAGGCCGG - Intergenic
1054776030 9:69124174-69124196 CTCAAAAAATAAAATAAGGCTGG - Intronic
1054909074 9:70437548-70437570 CTCCAAAAATAAATTAAGGCTGG - Intergenic
1055183790 9:73425028-73425050 CTCTGAAAATAAATCAAGGCTGG - Intergenic
1055417661 9:76101058-76101080 CTAGAAAAAAAAATTGAACCGGG - Intronic
1055730082 9:79271823-79271845 CTAAAAAAAAAAATTGATGCTGG - Intergenic
1055739803 9:79375183-79375205 CTATAAAGATAAATCCAGGAGGG + Intergenic
1055783330 9:79843841-79843863 CTATAAAAATAAATTAAAATAGG + Intergenic
1056095325 9:83247461-83247483 CTATACAACTAAATTTATGCTGG - Exonic
1056110402 9:83389242-83389264 CTGTAAAAAGCTATTGAGGCTGG - Intronic
1056212433 9:84377139-84377161 CTTAAAAAATAAAGTCAGGCTGG - Intergenic
1056490398 9:87101247-87101269 CTTTAAGAAGAAATTGAAGCTGG - Intergenic
1056534002 9:87512006-87512028 CTAGAAAAATAAAATCAGGCCGG - Intronic
1057032567 9:91787212-91787234 GTTTAAAAATAAAAAGAGGCTGG + Intronic
1057165825 9:92924593-92924615 CTATTGTAAGAAATTGAGGCCGG - Intergenic
1057338711 9:94179937-94179959 CTACAAAAATAAAATTAGCCAGG - Intergenic
1057779559 9:98038345-98038367 CTTTAAAAATAAATTAGGCCGGG - Intergenic
1058156856 9:101525409-101525431 CTATGAAAATAAATGTTGGCGGG + Intronic
1058325149 9:103687036-103687058 CTATAAAAATATTTTCTGGCCGG + Intergenic
1058399767 9:104601509-104601531 ATATTAAAATAAAATGGGGCCGG - Intergenic
1058400217 9:104607679-104607701 CTATTAAAATAAAATGGGGCCGG - Intergenic
1058909657 9:109509020-109509042 CTTTAAAAATAAATAGAGATGGG - Intergenic
1059080089 9:111239520-111239542 CTATAAAAATAATTGGACACCGG - Intergenic
1059100272 9:111464885-111464907 TTAAAAAAATAAAATAAGGCCGG + Intronic
1059108931 9:111536185-111536207 ATATATATATAAATTGTGGCCGG - Intronic
1060116509 9:120945502-120945524 CAATAAAAGTAACTTGTGGCTGG - Intergenic
1060164892 9:121403781-121403803 AAATAAAAATAAATAGATGCTGG + Intergenic
1060381749 9:123181633-123181655 CTAAAAATATAAATTTAGCCAGG + Intronic
1060464361 9:123889674-123889696 GTATAAAAATCAAAAGAGGCCGG + Intronic
1060577080 9:124706069-124706091 TTAAAAAAATAAAATCAGGCTGG - Intronic
1060693658 9:125687477-125687499 CTATAAAACAAAATAGAGGCTGG + Intronic
1060873810 9:127065406-127065428 CTACAAAAATATTTTAAGGCCGG - Intronic
1061021526 9:128018731-128018753 CTAAAAAAAAAAATTGAGCTGGG - Intergenic
1061081928 9:128376200-128376222 AAATAAAAATAAAATTAGGCAGG + Intronic
1061291366 9:129651976-129651998 TTAAAAATATAACTTGAGGCCGG + Intergenic
1061496206 9:130976003-130976025 CTATAAAATTAAATTAGGCCAGG - Intergenic
1061525636 9:131159208-131159230 CTATATAATTAAAATGAGGCCGG - Intronic
1061547335 9:131312299-131312321 CTACAAAAATAAAAATAGGCTGG - Intergenic
1061599013 9:131653944-131653966 CAATAAAAATAAATTAAGTACGG + Intronic
1203655537 Un_KI270752v1:20700-20722 CTATACAAAGAAAATGAAGCTGG - Intergenic
1185515581 X:696735-696757 CTAAAAAAAAAAAAAGAGGCCGG - Intergenic
1185558390 X:1039385-1039407 CTAAAAAAATAAAAAGAGGATGG + Intergenic
1185602153 X:1347740-1347762 CTTTAGAAAAAAATTGTGGCCGG + Intronic
1185632114 X:1522770-1522792 CTAAAAATAAAAATTAAGGCCGG + Intronic
1185756543 X:2657942-2657964 AGATTAAAATAATTTGAGGCAGG - Intergenic
1185789260 X:2916191-2916213 CCATAAAAAAGAATGGAGGCTGG + Intronic
1185883637 X:3762242-3762264 CCTTAAAATCAAATTGAGGCTGG + Intergenic
1185975878 X:4719500-4719522 TTAAAAAAAAAAAGTGAGGCCGG - Intergenic
1186334228 X:8569344-8569366 TCATAAAAATAAAGTGGGGCTGG + Intronic
1186397214 X:9222181-9222203 GCAGAAAAATAGATTGAGGCAGG - Intergenic
1186833849 X:13418071-13418093 TTAAAAAAAGAAGTTGAGGCTGG - Intergenic
1186949451 X:14607204-14607226 CTTTCAAAATAAACTGGGGCAGG - Exonic
1187109049 X:16277133-16277155 GTGGAAAAATAACTTGAGGCTGG - Intergenic
1187165025 X:16796985-16797007 CTTAAAAAATGAAATGAGGCTGG + Intronic
1187649119 X:21380742-21380764 CATTAAGAACAAATTGAGGCTGG - Intronic
1187736643 X:22311644-22311666 TTATAAGAATAGATTGAGGAGGG - Intergenic
1187884497 X:23876502-23876524 CTATTAAAAAAAATTAAGGCCGG + Intronic
1187908443 X:24088641-24088663 ATTTAAAAATAAAATTAGGCTGG - Intergenic
1188152700 X:26698023-26698045 TTAAAAAAATTAATTTAGGCTGG - Intergenic
1188180176 X:27045674-27045696 AAAGAAAAATAAATTGAGTCTGG - Intergenic
1188352167 X:29145023-29145045 CTTTAAAAATAAGATCAGGCCGG - Intronic
1189240094 X:39518151-39518173 CTTTAAAAACAATGTGAGGCCGG - Intergenic
1189290970 X:39885936-39885958 CAATAAAAAAATATTGAGGAAGG + Intergenic
1189432714 X:40961918-40961940 CTATAAAAATATATTTTGGGGGG + Intergenic
1189914896 X:45847365-45847387 CTTAAAAAATAAATGGAAGCTGG - Intergenic
1189992062 X:46604726-46604748 CAATAAAATAAAATTGAGACCGG - Intronic
1190101390 X:47525076-47525098 ATAGAAGAATAAATGGAGGCTGG - Intergenic
1190109403 X:47580332-47580354 CTTAAAAAATAGATTTAGGCTGG + Intronic
1190152588 X:47960219-47960241 ATAAATAAATAAATAGAGGCAGG + Intronic
1190238917 X:48641500-48641522 ATTTAAAAATAAATGTAGGCCGG - Intergenic
1190257162 X:48772236-48772258 CTAAAAAATTAAAATAAGGCTGG + Intronic
1190303391 X:49068914-49068936 CTGTAAACATAAATGGAGGAAGG - Intronic
1190339998 X:49288837-49288859 CTTTAAGAATACAATGAGGCAGG + Intronic
1190411776 X:50143700-50143722 CTATAAAAACACATTGAGTTTGG + Intergenic
1190575352 X:51831313-51831335 ATTTAAAAATAATTTTAGGCTGG + Intronic
1190818161 X:53947297-53947319 CTTTAAAAATATAATAAGGCTGG - Intronic
1190819674 X:53961613-53961635 TTTTAAAAAAAAATTGGGGCCGG - Intronic
1191056081 X:56242737-56242759 CCACAAAAATAAATGAAGGCTGG - Intronic
1192392023 X:70739704-70739726 CTTTAAAAATAGATTCAGGCTGG - Intronic
1193104324 X:77651946-77651968 TAATAGAAATAAATTAAGGCTGG + Intronic
1193117373 X:77788453-77788475 ATTTAAAAATAATGTGAGGCAGG - Intergenic
1193275592 X:79583824-79583846 CTAGAAAAATACTTTAAGGCCGG + Intergenic
1193489097 X:82125943-82125965 CTATAAAAATAAAAAGAGAAAGG + Intergenic
1193637121 X:83964964-83964986 ATACAAAAATAAATTCAGGATGG + Intergenic
1194311404 X:92312690-92312712 CTGTAAAAATGATTTGTGGCTGG - Intronic
1194538380 X:95137605-95137627 TTATAAAAATAGAATTAGGCCGG + Intergenic
1194640542 X:96399006-96399028 CAAAAAAATAAAATTGAGGCCGG + Intergenic
1195253910 X:103075350-103075372 TTATAAAAAGCAATTGCGGCTGG - Intergenic
1195267362 X:103195831-103195853 CTTTAAAAATAGATAGTGGCCGG + Intergenic
1195371981 X:104185201-104185223 CAATTAAAATAAATTAAGGCCGG - Intronic
1195506341 X:105661632-105661654 CTATAAAAATACATGGAGGCTGG + Intronic
1195631547 X:107060621-107060643 CAATAAAAAAAAATGGAGGCAGG - Intergenic
1195643394 X:107202560-107202582 GTAAAAAAATAAATTCAGGCTGG + Intronic
1195815811 X:108886031-108886053 CTGTAAAAAAAAATTGAGACTGG - Intergenic
1195951869 X:110283823-110283845 TAATTAAAATAAAATGAGGCTGG + Intronic
1196352345 X:114746687-114746709 CTAAAAAAAAAAAGAGAGGCCGG + Intronic
1196419135 X:115505120-115505142 CTTTAAAAATAAACTCAGCCAGG - Intergenic
1196606240 X:117660579-117660601 CTTTAAAAAAAAATAGAGACAGG - Intergenic
1196758457 X:119178315-119178337 ATATAAAAAGAGATTCAGGCCGG - Intergenic
1197062984 X:122203738-122203760 CTATAAAGAAATACTGAGGCTGG - Intergenic
1197258633 X:124291868-124291890 CTATAAAAACTACCTGAGGCTGG - Intronic
1197552132 X:127904257-127904279 CTATTCAAAAAAATTGAGGAGGG + Intergenic
1197751358 X:129965949-129965971 ATATAAAAGCATATTGAGGCCGG - Intergenic
1198063408 X:133070918-133070940 CTATAAAATTAAATGGTGGCCGG + Intronic
1198221747 X:134608968-134608990 CTAAAAAAAGAAAAAGAGGCCGG - Intronic
1198458654 X:136842412-136842434 CTACAAAAATAAAATTAGCCAGG + Intergenic
1198589792 X:138165088-138165110 CTTTAAAAATAAATACAGGTGGG - Intergenic
1198626298 X:138579338-138579360 CTATAAAAAAAATTTGGGTCTGG + Intergenic
1198651737 X:138870669-138870691 CTCTTAAAATAAAATGAGGAAGG + Intronic
1199739186 X:150717061-150717083 CTAAAAAAAGCAAATGAGGCCGG + Intronic
1200023368 X:153231028-153231050 CTTCAAAAATAAATAGTGGCTGG - Intergenic
1200331878 X:155306476-155306498 CTATAAAAAAAATCTGAGCCTGG - Intronic
1200781795 Y:7223330-7223352 CCTTAAAATCAAATTGAGGCTGG - Intergenic
1201521772 Y:14883376-14883398 CTACAAAAATTAATTGAAGATGG - Intergenic
1202110478 Y:21411671-21411693 CAATAAAAATAAAATTATGCTGG - Intergenic