ID: 1107857940

View in Genome Browser
Species Human (GRCh38)
Location 13:44633920-44633942
Sequence CCGCGCCCGGCCCTGTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857940_1107857953 24 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857953 13:44633967-44633989 CTTTGGGAGGCCGAGGCGGGTGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766
1107857940_1107857951 20 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857951 13:44633963-44633985 AGCACTTTGGGAGGCCGAGGCGG 0: 87986
1: 182858
2: 138884
3: 74939
4: 51691
1107857940_1107857947 11 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857947 13:44633954-44633976 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1107857940_1107857949 17 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857949 13:44633960-44633982 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1107857940_1107857946 8 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857946 13:44633951-44633973 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013
1107857940_1107857952 21 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857952 13:44633964-44633986 GCACTTTGGGAGGCCGAGGCGGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1107857940_1107857945 7 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857945 13:44633950-44633972 GGCTTGTAATCCCAGCACTTTGG 0: 212
1: 13629
2: 236982
3: 276285
4: 184833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857940 Original CRISPR CCGCGCCCGGCCCTGTTTTT TGG (reversed) Intergenic
No off target data available for this crispr