ID: 1107857945

View in Genome Browser
Species Human (GRCh38)
Location 13:44633950-44633972
Sequence GGCTTGTAATCCCAGCACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 711941
Summary {0: 212, 1: 13629, 2: 236982, 3: 276285, 4: 184833}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107857944_1107857945 -6 Left 1107857944 13:44633933-44633955 CCGGGCGCGGTGGCTCAGGCTTG 0: 10
1: 1577
2: 37442
3: 95224
4: 158880
Right 1107857945 13:44633950-44633972 GGCTTGTAATCCCAGCACTTTGG 0: 212
1: 13629
2: 236982
3: 276285
4: 184833
1107857935_1107857945 22 Left 1107857935 13:44633905-44633927 CCATCTCAAAAGAAACCAAAAAA No data
Right 1107857945 13:44633950-44633972 GGCTTGTAATCCCAGCACTTTGG 0: 212
1: 13629
2: 236982
3: 276285
4: 184833
1107857940_1107857945 7 Left 1107857940 13:44633920-44633942 CCAAAAAACAGGGCCGGGCGCGG No data
Right 1107857945 13:44633950-44633972 GGCTTGTAATCCCAGCACTTTGG 0: 212
1: 13629
2: 236982
3: 276285
4: 184833

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107857945 Original CRISPR GGCTTGTAATCCCAGCACTT TGG Intergenic
Too many off-targets to display for this crispr