ID: 1107857945 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:44633950-44633972 |
Sequence | GGCTTGTAATCCCAGCACTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 711941 | |||
Summary | {0: 212, 1: 13629, 2: 236982, 3: 276285, 4: 184833} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1107857944_1107857945 | -6 | Left | 1107857944 | 13:44633933-44633955 | CCGGGCGCGGTGGCTCAGGCTTG | 0: 10 1: 1577 2: 37442 3: 95224 4: 158880 |
||
Right | 1107857945 | 13:44633950-44633972 | GGCTTGTAATCCCAGCACTTTGG | 0: 212 1: 13629 2: 236982 3: 276285 4: 184833 |
||||
1107857935_1107857945 | 22 | Left | 1107857935 | 13:44633905-44633927 | CCATCTCAAAAGAAACCAAAAAA | No data | ||
Right | 1107857945 | 13:44633950-44633972 | GGCTTGTAATCCCAGCACTTTGG | 0: 212 1: 13629 2: 236982 3: 276285 4: 184833 |
||||
1107857940_1107857945 | 7 | Left | 1107857940 | 13:44633920-44633942 | CCAAAAAACAGGGCCGGGCGCGG | No data | ||
Right | 1107857945 | 13:44633950-44633972 | GGCTTGTAATCCCAGCACTTTGG | 0: 212 1: 13629 2: 236982 3: 276285 4: 184833 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1107857945 | Original CRISPR | GGCTTGTAATCCCAGCACTT TGG | Intergenic | ||
Too many off-targets to display for this crispr |